ID: 1067066108

View in Genome Browser
Species Human (GRCh38)
Location 10:43105168-43105190
Sequence CTTCCGCTTGAACTCCACCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067066108_1067066113 25 Left 1067066108 10:43105168-43105190 CCGTGGTGGAGTTCAAGCGGAAG 0: 1
1: 0
2: 2
3: 5
4: 82
Right 1067066113 10:43105216-43105238 GTCTACCCAGTGTCTGTCTCCGG 0: 1
1: 1
2: 0
3: 11
4: 139
1067066108_1067066111 3 Left 1067066108 10:43105168-43105190 CCGTGGTGGAGTTCAAGCGGAAG 0: 1
1: 0
2: 2
3: 5
4: 82
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067066108 Original CRISPR CTTCCGCTTGAACTCCACCA CGG (reversed) Exonic
900164664 1:1239903-1239925 CTTCTCCGTGACCTCCACCAGGG - Intergenic
907078665 1:51601473-51601495 CTTCAGCTTCATCTCCCCCATGG + Intronic
908147745 1:61265336-61265358 CTTCTGTTTGAATTCTACCATGG - Intronic
911792961 1:102041447-102041469 CCACCGCTGGAACACCACCAGGG - Intergenic
913088323 1:115459079-115459101 GGTCCGCTTGATCTCCACCAGGG - Intergenic
914252839 1:145935897-145935919 CTTCCTCTTGGACTCAAACAGGG - Exonic
918881354 1:190126381-190126403 TTCCCACTTGACCTCCACCATGG + Intronic
920878233 1:209857116-209857138 CTTCTGCTTGAATTCCTTCAAGG + Exonic
924718514 1:246601468-246601490 CTTCCCACTGGACTCCACCAGGG - Intronic
1063987575 10:11522007-11522029 CTCCAGCTTTAACTCCATCATGG + Intronic
1067066108 10:43105168-43105190 CTTCCGCTTGAACTCCACCACGG - Exonic
1067563094 10:47317618-47317640 CTTCCCCCTGTCCTCCACCAGGG - Intergenic
1072768444 10:98115657-98115679 CTCCCGGCAGAACTCCACCATGG + Intergenic
1079169986 11:18084376-18084398 CTTCTGCTTAAAACCCACCATGG + Intronic
1079180497 11:18189368-18189390 CATCCGCGTCAACGCCACCAAGG + Exonic
1081739589 11:45429098-45429120 ATTATGCTTGAACTCCTCCAGGG - Intergenic
1084271071 11:68029532-68029554 CCTCAGCTTGAACTCCCCCAGGG + Intergenic
1087008138 11:93488843-93488865 CTTCCTCTTCAACTCCCCCAAGG - Intronic
1089390727 11:118099821-118099843 CTTCAGCTTGGCCTTCACCATGG + Intronic
1090666042 11:128915652-128915674 CTACGCCTTGAACTCCTCCAGGG + Intronic
1091194782 11:133721297-133721319 CTTCTGCTTGAACACCCACATGG - Intergenic
1091773625 12:3169910-3169932 CATCCACTTGAACCCAACCATGG + Intronic
1099975453 12:89541604-89541626 CTCCCCCTTGGACCCCACCAAGG + Intergenic
1101623624 12:106416699-106416721 CTTCCCCTGAAACTCCTCCATGG + Intronic
1111626081 13:90788841-90788863 CTCCCACTTGAACTCCTCTATGG - Intergenic
1113890439 13:113732544-113732566 CCTCCGTTTTCACTCCACCACGG - Intronic
1120565331 14:86048204-86048226 CATCAGTTTGAAGTCCACCAGGG - Intergenic
1124576378 15:30912569-30912591 CTTCCCCTTCAACTCCATGATGG + Intronic
1132673460 16:1112074-1112096 CAGCTGCTTGAACTCCTCCAGGG - Intergenic
1132827312 16:1911766-1911788 CTTCTACTTCAACGCCACCAAGG - Exonic
1142983009 17:3682156-3682178 GTCCAGCTTGAGCTCCACCATGG - Intronic
1143260810 17:5596937-5596959 CTACACCTTTAACTCCACCAAGG - Intronic
1144241257 17:13314850-13314872 CTTTAGCTTGAACTCTTCCAAGG + Intergenic
1146657234 17:34641812-34641834 CTCCCGCTTGAACTCCACGAGGG - Intergenic
1150311294 17:64130802-64130824 CTTCCGCTTGGAATGAACCACGG + Intronic
1152749148 17:82054575-82054597 CTTCCGCGTGGCCTCCACCCAGG - Exonic
1158022391 18:52858691-52858713 TTTCAGTTTGAACTCCCCCATGG - Intronic
1160355495 18:78225034-78225056 TTTGCGGTTGAACTCCACCCTGG + Intergenic
925891732 2:8439914-8439936 CCTCCACTTGAACTTCCCCATGG - Intergenic
932430616 2:71671858-71671880 CTTCCTCTGGAACTCGCCCACGG - Intronic
933608183 2:84406342-84406364 GTTCTGCTTGAATCCCACCAGGG - Intergenic
934033787 2:88071571-88071593 CTTCCTCCTGAACTCCAACTTGG + Intronic
934123240 2:88860881-88860903 CTTACGTTTGATCTCCACCTTGG + Intergenic
936730435 2:115375772-115375794 CTCTCTCTTGCACTCCACCATGG - Intronic
938292433 2:130157247-130157269 CCACCGTTTGAACTCCTCCAGGG + Exonic
938464121 2:131515729-131515751 CCACCGTTTGAACTCCTCCAGGG - Intergenic
941107175 2:161367798-161367820 CTTCCATTGGAACTCCAGCACGG - Exonic
942261758 2:174172220-174172242 CTTGAACTGGAACTCCACCACGG - Intronic
947203240 2:227635429-227635451 CTTGAGCTTGCACTCCATCAGGG + Intergenic
1172167728 20:32909095-32909117 CTCGTGCTTGAGCTCCACCAAGG + Intronic
1172750662 20:37248750-37248772 CTTCTGCTTAAACTCCACCATGG + Intergenic
1179967185 21:44814024-44814046 CTTGATCTTGAACTGCACCACGG + Exonic
1180995449 22:19963138-19963160 CTCCCGCTTGAACTTCAGCCTGG + Intronic
1181313812 22:21959615-21959637 CTTCCTCTTGAACACGTCCAGGG + Exonic
1181402589 22:22660429-22660451 CTTCCCCTGAAGCTCCACCAAGG + Intergenic
1183741619 22:39671598-39671620 CTTCCCCTCCAACTCCATCAGGG - Intronic
1184918759 22:47590986-47591008 CCTGCCCTTGAGCTCCACCAGGG + Intergenic
950534025 3:13569213-13569235 CTTAGGCCTGAACTCCCCCAAGG - Intronic
953581887 3:44164980-44165002 CTTCAGCTGTAACTGCACCAAGG - Intergenic
954406754 3:50349453-50349475 CTTCTGCTTGCTCTCCTCCATGG + Exonic
962071768 3:132041220-132041242 CTTCCCCTTGAACGTCACCAGGG + Intronic
966212653 3:177469282-177469304 CTTCCACCTCTACTCCACCAGGG - Intergenic
969265950 4:6064125-6064147 CTTCCCCTTGCTCCCCACCAGGG - Intronic
969289493 4:6229641-6229663 CTTCTGCTTGCACACCTCCAGGG - Intergenic
970510009 4:16772446-16772468 CTCCCTCTTGAACTCCCACAGGG + Intronic
975400366 4:73930286-73930308 CTCCAGCTAGAACTCCACCTGGG - Intergenic
997831822 5:137157020-137157042 CTTGGGCTTGCACTCCCCCATGG + Intronic
1006977405 6:38115920-38115942 CTGCCCTATGAACTCCACCATGG - Intronic
1007482995 6:42162492-42162514 CTCCAGCTTGCCCTCCACCAGGG - Intronic
1009685831 6:66955686-66955708 CTTCCCCTTCACCTCCACCGTGG - Intergenic
1013018360 6:106182381-106182403 CTTCCTATTGAACTCTAGCATGG - Intergenic
1014153524 6:118085767-118085789 CTTATGTTTGAACTCCTCCACGG - Intronic
1015080537 6:129220044-129220066 CTTGAGCTGGTACTCCACCAGGG - Intronic
1034074345 7:148217433-148217455 CTTCAGCTTCAGCACCACCAAGG + Exonic
1035131760 7:156661181-156661203 CTTCAGCTTAAACTCCAGCAAGG + Intronic
1035464117 7:159063986-159064008 CTTCCTCTTGAACCCCAGCCCGG - Intronic
1037565620 8:20115872-20115894 CTTTTGCTTGGACTCCAACATGG - Intergenic
1038738461 8:30194203-30194225 ATGCCGCTTGCACTCCAGCATGG + Intergenic
1038966595 8:32579968-32579990 ATTCCTCTTTAACTGCACCAAGG + Intronic
1039204961 8:35141805-35141827 CCTCCCCTCCAACTCCACCAAGG + Intergenic
1043291402 8:78605978-78606000 CTTTCTCTTGAGCTCCACCTTGG - Intergenic
1049179158 8:141212233-141212255 CTTCCGCGTGAGCTTCAGCACGG + Exonic
1050849059 9:10261394-10261416 ATTTCAATTGAACTCCACCAGGG - Intronic
1059993638 9:119888732-119888754 CACCCGCTTGAACTTCAGCAGGG + Intergenic
1060325849 9:122614947-122614969 CATCTGCTTCACCTCCACCACGG + Exonic
1190000864 X:46685240-46685262 CTGGCACTGGAACTCCACCAGGG + Intronic
1195754370 X:108186790-108186812 CTTCTTCTTGAACTCTCCCAGGG + Intronic
1196328311 X:114435537-114435559 CTTCTGCTTGTTCACCACCACGG + Intergenic
1201012040 Y:9556975-9556997 GTTCAGCTTGGACTCAACCAGGG - Intergenic
1201616834 Y:15909780-15909802 CTTCAGCTTGGATTGCACCAAGG - Intergenic