ID: 1067066111

View in Genome Browser
Species Human (GRCh38)
Location 10:43105194-43105216
Sequence GTGCTTGTCCGCGCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067066100_1067066111 29 Left 1067066100 10:43105142-43105164 CCCCGCGGGCGTCGACACCGCCA 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066102_1067066111 27 Left 1067066102 10:43105144-43105166 CCGCGGGCGTCGACACCGCCAGC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066105_1067066111 12 Left 1067066105 10:43105159-43105181 CCGCCAGCGCCGTGGTGGAGTTC 0: 1
1: 1
2: 0
3: 12
4: 105
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066101_1067066111 28 Left 1067066101 10:43105143-43105165 CCCGCGGGCGTCGACACCGCCAG 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066106_1067066111 9 Left 1067066106 10:43105162-43105184 CCAGCGCCGTGGTGGAGTTCAAG 0: 1
1: 0
2: 0
3: 11
4: 52
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1067066108_1067066111 3 Left 1067066108 10:43105168-43105190 CCGTGGTGGAGTTCAAGCGGAAG 0: 1
1: 0
2: 2
3: 5
4: 82
Right 1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067066111 Original CRISPR GTGCTTGTCCGCGCGTGCTG TGG Intronic
901028972 1:6295116-6295138 GTGCTCGGCCGCACGTGCTGTGG + Intronic
1062812880 10:478817-478839 TCGCGTGTCCGGGCGTGCTGGGG + Intronic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG + Intronic
1077306348 11:1870326-1870348 GTGTATGTCCCCGGGTGCTGCGG - Intronic
1077483630 11:2828178-2828200 GTGCTAGTCCCTGCCTGCTGAGG - Intronic
1078417864 11:11180489-11180511 ATGGTTGTCCGCGGGGGCTGTGG - Intergenic
1083669510 11:64292192-64292214 GCGCTTGGCGGCGCGTGCCGGGG + Intronic
1091604280 12:1936861-1936883 GTGCGTGGCCGCGCAGGCTGGGG - Intergenic
1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG + Intronic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1107451578 13:40515021-40515043 GTGCTGGTCCCCTCTTGCTGTGG + Intergenic
1112319737 13:98395452-98395474 GTGCTTGGCTGCGGGGGCTGAGG - Exonic
1118293735 14:64549876-64549898 GTCCTAGGCCGCGCGGGCTGCGG - Intergenic
1126312226 15:47330515-47330537 GAGCTTGTCAGGGCGTGCAGAGG + Intronic
1133583400 16:7167912-7167934 GTGCTTGTCTGGGGATGCTGCGG + Intronic
1136479574 16:30533205-30533227 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1136483351 16:30556164-30556186 GTCCCTGTCCACGCGGGCTGTGG - Intronic
1137244014 16:46688583-46688605 GTGTTTGTCAGCGAGTTCTGGGG - Intronic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1157260918 18:46174652-46174674 GTCCTTTTCCGGGGGTGCTGAGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160540522 18:79617803-79617825 CTGCTTGTCCGCGCGGGGTCGGG - Intergenic
1161332067 19:3693156-3693178 GTGCTTTCCTGCGTGTGCTGTGG - Intronic
932462398 2:71891428-71891450 GGGCTTCTCTGCGGGTGCTGCGG - Intergenic
947100687 2:226618164-226618186 GTGCTTGTGTGAGTGTGCTGGGG - Intergenic
948669954 2:239561848-239561870 GTGCTTGTCCTCAAGTGATGGGG - Intergenic
948788897 2:240366873-240366895 GTGCATGTGCGTGCATGCTGGGG - Intergenic
1175700598 20:61134141-61134163 GTGCTGGTCCGGGAGGGCTGTGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1179934310 21:44592630-44592652 GTGTTTGTTCGCCCGTGATGTGG + Intronic
1180796258 22:18607201-18607223 GAGCTTGTCCTTGCCTGCTGTGG + Exonic
1181225464 22:21388070-21388092 GAGCTTGTCCTTGCCTGCTGTGG - Exonic
1181253169 22:21546743-21546765 GAGCTTGTCCTTGCCTGCTGTGG + Exonic
1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG + Intronic
950509142 3:13415312-13415334 GTGCTTGTCCCCTGGTGCTCAGG + Intronic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
985751975 5:1685866-1685888 GTGCATGTGCGCGTGTGCTGAGG + Intergenic
996614895 5:125429526-125429548 GTGCTTCTCAGTGAGTGCTGTGG - Intergenic
1010350102 6:74863417-74863439 GTGCTTGTGCCCACATGCTGGGG - Intergenic
1018551361 6:165001914-165001936 GTGCTGGCCCGCGAGCGCTGGGG + Intergenic
1019931336 7:4225354-4225376 GTGCTTGTCCGAGCAGGCTGGGG - Intronic
1042787960 8:72570778-72570800 GTGTTTGTCCTCACTTGCTGAGG + Intronic
1049176393 8:141195274-141195296 GAGCGTGTCAGCACGTGCTGAGG + Exonic
1058532958 9:105925093-105925115 GTGCTTGTCCGACCTGGCTGAGG - Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1186349949 X:8731234-8731256 GTGCGTGTATGCGCGTGTTGGGG - Intronic
1189915378 X:45851190-45851212 GCGCTTCTGCGCGCGCGCTGTGG - Intergenic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic