ID: 1067066428

View in Genome Browser
Species Human (GRCh38)
Location 10:43106531-43106553
Sequence GGCCAACGGCAGCTTCGTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067066422_1067066428 -3 Left 1067066422 10:43106511-43106533 CCCAACGAGACCTCGGTCCAGGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG 0: 1
1: 0
2: 2
3: 4
4: 85
1067066418_1067066428 17 Left 1067066418 10:43106491-43106513 CCTTCCGGGTGGAACACTGGCCC 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG 0: 1
1: 0
2: 2
3: 4
4: 85
1067066419_1067066428 13 Left 1067066419 10:43106495-43106517 CCGGGTGGAACACTGGCCCAACG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG 0: 1
1: 0
2: 2
3: 4
4: 85
1067066423_1067066428 -4 Left 1067066423 10:43106512-43106534 CCAACGAGACCTCGGTCCAGGCC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG 0: 1
1: 0
2: 2
3: 4
4: 85
1067066415_1067066428 26 Left 1067066415 10:43106482-43106504 CCCAGCAGACCTTCCGGGTGGAA 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG 0: 1
1: 0
2: 2
3: 4
4: 85
1067066416_1067066428 25 Left 1067066416 10:43106483-43106505 CCAGCAGACCTTCCGGGTGGAAC 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG 0: 1
1: 0
2: 2
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067066428 Original CRISPR GGCCAACGGCAGCTTCGTGC GGG Exonic
900228766 1:1545324-1545346 GGCCAAGGGCAGCTTGGGCCGGG - Intronic
901438682 1:9264536-9264558 GGCCAACAGCAGCTTCGACCTGG + Exonic
905399317 1:37690413-37690435 GGCGACCGGCAGCCTCGGGCAGG - Exonic
905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG + Intergenic
905536279 1:38724552-38724574 AGCCAAGGGCAGCTTCCTGTTGG + Intergenic
913452686 1:119002714-119002736 GCCCAAAGGCATCTTAGTGCAGG - Intergenic
922314865 1:224434099-224434121 GGTCAGCGGCAGCATCATGCAGG - Exonic
1067066428 10:43106531-43106553 GGCCAACGGCAGCTTCGTGCGGG + Exonic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1068060649 10:52064178-52064200 GGCTGACGGCAGCTTGGTGCTGG - Intronic
1077158590 11:1102481-1102503 GGGCAACTGCACCTACGTGCTGG + Intergenic
1079929304 11:26537908-26537930 GGCCCACTGCAGCTTAGAGCAGG - Intronic
1085334270 11:75679073-75679095 GGCTAAGGGCAGCTCAGTGCGGG - Intergenic
1087385182 11:97461589-97461611 GGCTGAGGGCAGCTTGGTGCAGG + Intergenic
1094022653 12:25930502-25930524 GGCCGTCTGCAGCTTCCTGCAGG + Intergenic
1097275663 12:57811737-57811759 GGCCAAGATCAGCTTCTTGCAGG - Intronic
1107170936 13:37341480-37341502 GACTAAGGGCAGCTTGGTGCAGG + Intergenic
1113803087 13:113096513-113096535 GGTCAGCGGCAGCCACGTGCGGG - Intronic
1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG + Intergenic
1122408976 14:101516566-101516588 GGCCGACGGCTGCTTCTTGAGGG + Intergenic
1124436236 15:29651809-29651831 GGCTGAGGGCAGCTTGGTGCTGG + Intergenic
1128226709 15:66006794-66006816 AGCCAAGGGCAGCTCCCTGCTGG + Intronic
1131788262 15:95936351-95936373 TGCAAACGGCATCTTCTTGCAGG + Intergenic
1133561932 16:6958235-6958257 TGCTAACGGCTGCATCGTGCAGG - Intronic
1134672818 16:16068281-16068303 GGTCATCAGCAGCATCGTGCAGG + Exonic
1139433480 16:66923627-66923649 GGACAAGGGCAGCTTCGAGAAGG - Exonic
1139909458 16:70388431-70388453 CGCCAACGTCAGCTTCGTGCTGG - Exonic
1141667035 16:85470977-85470999 GGCCCACTGAAGCTTGGTGCTGG + Intergenic
1142425770 16:90001526-90001548 GGCCAGGGGCAGCCACGTGCTGG - Intergenic
1142774358 17:2124549-2124571 GGCCAAAGGCATCTTCTTCCTGG + Intronic
1145217117 17:21060950-21060972 GGCTGAGGGCAGCTTGGTGCTGG - Intergenic
1146086896 17:29838307-29838329 GGCCAAGGGCAGCTTGGTGTTGG + Intronic
1146628237 17:34450473-34450495 GTCCAAGGGCAGCTTCGGGAAGG - Intergenic
1147308633 17:39580456-39580478 GCCCTACGCCAGCTTTGTGCTGG + Intergenic
1147953023 17:44117528-44117550 CCCCAACGCCAGCTTCCTGCAGG - Exonic
1152596366 17:81239573-81239595 GGCGTACGGCAGGTGCGTGCAGG + Exonic
1158968592 18:62644951-62644973 GCCCCACGGCAGCATCTTGCAGG - Intergenic
1159946592 18:74448454-74448476 AGCAAAGGGCAGCTTGGTGCTGG + Intronic
1160766927 19:812863-812885 GGCCGACGGCGGCTACGAGCTGG - Exonic
1163462635 19:17448250-17448272 GGCCAGCGGCAGCAGCGTCCCGG + Exonic
925386845 2:3467929-3467951 GGCTAATGGCAGCTACGCGCAGG - Intronic
928797032 2:35034807-35034829 GGCTAAGGGCAGCTTGGTGTAGG - Intergenic
930033878 2:47073827-47073849 AGTCAACGGCAGCCTCGTTCTGG - Exonic
931229726 2:60364290-60364312 AGCCAAAGGCAGCTTCTTTCTGG + Intergenic
937308001 2:120884073-120884095 GGCCAGGGGCAGCTCAGTGCTGG + Intronic
947646336 2:231744145-231744167 CTCCAACTGCAGCTTTGTGCAGG - Intronic
947748634 2:232522014-232522036 GGCCCACGGCCGCATCGTGGGGG + Exonic
947875130 2:233462645-233462667 GCTCAACTGCAGCTTCGTCCTGG + Exonic
1175818820 20:61897571-61897593 TGCCAAGGGCTGCTTAGTGCTGG - Intronic
1176408359 21:6434135-6434157 GGCTGACGGCAGCTTGCTGCTGG + Intergenic
1177433339 21:21019059-21019081 GGCCAATGACTGCTTAGTGCTGG + Intronic
1179547009 21:42119185-42119207 CACCAACGGCAGCATCGTGGTGG + Exonic
1181021195 22:20104118-20104140 GGCCTCAGGCAGCTTGGTGCAGG + Intronic
1182299644 22:29330416-29330438 GACCAACGGCATCTGGGTGCTGG - Exonic
949454261 3:4222270-4222292 GGCCAAAGGCAGCTTCCTTGAGG - Intronic
954800812 3:53186006-53186028 GGGCAAAGGCAGCTTCGGGAAGG + Exonic
962848378 3:139289952-139289974 GCCCAAAGGCAGCTTAATGCAGG - Intronic
965367728 3:167820646-167820668 GGCTAAAGGCAGCTCAGTGCAGG + Intronic
969594516 4:8141406-8141428 GGCCAACGGAAGCTAGCTGCGGG - Intronic
970959608 4:21856952-21856974 GGCCAAGGGCAGCTCAGAGCTGG + Intronic
978301096 4:107270291-107270313 TGCCAAGTGCAGCTTGGTGCTGG - Intronic
980740702 4:136946683-136946705 GGCTGAGGGCAGCTTGGTGCAGG + Intergenic
985673584 5:1218946-1218968 GGACAACGGCATCTTGGTGATGG - Exonic
990308891 5:54518969-54518991 GGCCACCGGCCGCTTCGAGGAGG + Exonic
995187844 5:109290343-109290365 GGCCAACTGCAGCTTGTTGAAGG - Intergenic
1001165049 5:169357097-169357119 GGACTACTGCAGCTTCCTGCAGG - Intergenic
1015755287 6:136600074-136600096 GGCCAAGGGCAGGTTTTTGCAGG - Intronic
1017716429 6:157216905-157216927 CTCCAAAGGCAGCTTCCTGCAGG - Intergenic
1019425661 7:975437-975459 GGACAAGGGCAGCTTCCCGCTGG - Exonic
1022471072 7:30682226-30682248 GGCCAACTGCAGCCTGGCGCTGG - Intronic
1029899265 7:104022315-104022337 GGCTGAGGGCAGCTTGGTGCTGG + Intergenic
1030514101 7:110519568-110519590 GGCTGAGGGCAGCTTGGTGCTGG - Intergenic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1035361681 7:158317698-158317720 GGCCATCTGCAGCTTCGGGCGGG + Intronic
1035382161 7:158447048-158447070 GGCCAACAGCAGCTCCAGGCAGG + Intronic
1037799401 8:22024358-22024380 TTCCAACTGCAGCTTCCTGCCGG + Exonic
1037936965 8:22921470-22921492 GGCCAAGAGCAGCTTCCTGGTGG + Intronic
1045910634 8:107404077-107404099 TGCCAAGATCAGCTTCGTGCCGG + Intronic
1049826881 8:144674718-144674740 GGCTGAGGGCAGCTTGGTGCAGG - Intergenic
1053364922 9:37516034-37516056 GGCCTACGGCATCGCCGTGCGGG - Exonic
1057468499 9:95337521-95337543 GGCTGAGGGCAGCTTGGTGCTGG + Intergenic
1062023862 9:134331611-134331633 AGCCATCGGCACCTTCGTGGGGG - Intronic
1062031394 9:134363607-134363629 TGGCAACGGCAGCTTTGGGCAGG + Intronic
1062725401 9:138070470-138070492 GTCCAACCGGAGCTTCCTGCTGG + Intronic
1186694895 X:12019780-12019802 GGCCAAAGGCAGCTTCCTGCAGG - Intergenic
1189083544 X:37997643-37997665 GGCCAAGGACAGCTCAGTGCTGG + Intronic
1189272599 X:39761698-39761720 GGCAAAGGGCAGCCTGGTGCAGG - Intergenic
1192245919 X:69371459-69371481 GGCCAAGGGAAGCTTCCTGGTGG + Intergenic
1200114563 X:153764531-153764553 AGCCAACGCCAGCCTCGGGCAGG + Intronic
1200749189 Y:6929285-6929307 GGCCAAGGGTAGCTCAGTGCAGG - Intronic
1202073537 Y:21016525-21016547 GGCTAAGGGCAGCTTGGTGTGGG - Intergenic
1202078237 Y:21058379-21058401 GGCTAAGGGCAGCTTGGTGTGGG - Intergenic