ID: 1067068911

View in Genome Browser
Species Human (GRCh38)
Location 10:43118713-43118735
Sequence GAGACCTCTGAGTAGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068911_1067068917 19 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068917 10:43118755-43118777 GTCCTCACCCAGTTCGGGGCTGG No data
1067068911_1067068915 14 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068915 10:43118750-43118772 CATGTGTCCTCACCCAGTTCGGG No data
1067068911_1067068923 28 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068923 10:43118764-43118786 CAGTTCGGGGCTGGGCCCGTGGG No data
1067068911_1067068914 13 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068914 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
1067068911_1067068924 29 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068924 10:43118765-43118787 AGTTCGGGGCTGGGCCCGTGGGG No data
1067068911_1067068916 15 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068916 10:43118751-43118773 ATGTGTCCTCACCCAGTTCGGGG No data
1067068911_1067068918 20 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068918 10:43118756-43118778 TCCTCACCCAGTTCGGGGCTGGG No data
1067068911_1067068922 27 Left 1067068911 10:43118713-43118735 CCACAGGGCTACTCAGAGGTCTC 0: 1
1: 0
2: 2
3: 14
4: 187
Right 1067068922 10:43118763-43118785 CCAGTTCGGGGCTGGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068911 Original CRISPR GAGACCTCTGAGTAGCCCTG TGG (reversed) Intronic
900490689 1:2947518-2947540 GGGACCTCGGATGAGCCCTGAGG - Intergenic
901853760 1:12031451-12031473 GAGACCTCGCAGCAGGCCTGGGG + Intronic
902414219 1:16229661-16229683 GAGGTCTCTGGGCAGCCCTGTGG - Intergenic
902612570 1:17605780-17605802 GAGTTCTCAGGGTAGCCCTGAGG - Intronic
905891649 1:41521931-41521953 GAGGCCTGTGGGTGGCCCTGTGG - Intronic
906545875 1:46618985-46619007 GAGCCATCTGAGGAGCCATGTGG + Intergenic
908143077 1:61208066-61208088 GAGAACTCCCAGTAGACCTGTGG + Intronic
908166387 1:61463280-61463302 CAGACCTCTGAGAAGACATGGGG + Intergenic
908936568 1:69383519-69383541 AAGACCTCTGACAAGCCCTGAGG + Intergenic
909249992 1:73341514-73341536 GAAACCTCTGAGAAGCTCTAGGG + Intergenic
910304235 1:85743166-85743188 GAGACTTCTGAGTAGTCTAGAGG + Intronic
913450866 1:118991685-118991707 GGGAAGTCTGAGGAGCCCTGGGG + Intergenic
915526945 1:156481709-156481731 CAAATCTCTGAGTAGGCCTGTGG + Intronic
917792575 1:178508705-178508727 AAGCCCTCTGAGTAGCACTAGGG - Intergenic
918990809 1:191695187-191695209 AAGACCTCTGACATGCCCTGGGG + Intergenic
922290589 1:224206069-224206091 GAGAGCTCTCAGGAGTCCTGGGG - Intergenic
922530410 1:226341072-226341094 AAGACCTCTGACATGCCCTGGGG - Intergenic
1065841476 10:29704838-29704860 GACACCTCTCAGGAGTCCTGGGG + Intronic
1066239302 10:33517881-33517903 GCAACCTCTGAGTACCTCTGTGG - Intergenic
1067068911 10:43118713-43118735 GAGACCTCTGAGTAGCCCTGTGG - Intronic
1070664799 10:78335585-78335607 CAGGTCTCTGAGTAGCTCTGTGG - Intergenic
1070693969 10:78548058-78548080 GAGACCCAAGAGTAGCCCTCTGG - Intergenic
1070937726 10:80314318-80314340 GAGGCCTCTAGGTAGCACTGTGG - Intergenic
1071167532 10:82823758-82823780 GAGACCTCAGTCAAGCCCTGGGG - Intronic
1073123725 10:101136938-101136960 GTGACCCCTGAGTGGGCCTGGGG - Exonic
1074900545 10:117812887-117812909 TAGACCCCTCAGTGGCCCTGTGG + Intergenic
1074965785 10:118489873-118489895 AAGACCTCTGACATGCCCTGGGG - Intergenic
1076482435 10:130793295-130793317 GAGAACTCTGAATAGCACTGGGG - Intergenic
1077325802 11:1963522-1963544 CAGTCCTCTGAGTTCCCCTGAGG + Intronic
1077981909 11:7309397-7309419 CAGTCCTCTGAGTAGGTCTGGGG - Intronic
1078013022 11:7588313-7588335 GAGAACTGTGAGTAGCCAGGAGG - Intronic
1079002175 11:16767287-16767309 GGGGCCACTGAGAAGCCCTGGGG - Intergenic
1079639945 11:22792686-22792708 GAGACCTCTGGGTGGCCCCATGG + Intronic
1081735726 11:45402181-45402203 GAGGCCTCTGAGCTGCCATGAGG - Intergenic
1083262249 11:61529548-61529570 GAAACCTCAGTGTTGCCCTGGGG - Intronic
1085398017 11:76217290-76217312 GAGACCTCTGATTCCCCCAGGGG + Intergenic
1085529088 11:77181206-77181228 GAGGCCTCTGAGTGGTCCAGAGG + Intronic
1085764265 11:79269614-79269636 GAGGGCCCTGAGGAGCCCTGAGG - Intronic
1089619455 11:119714018-119714040 GAGGCTTCTGAGTTGCTCTGAGG + Intronic
1090440251 11:126719430-126719452 GACAGCTCGGAGAAGCCCTGAGG - Intronic
1202808782 11_KI270721v1_random:18701-18723 CAGTCCTCTGAGTTCCCCTGAGG + Intergenic
1093536078 12:20225227-20225249 GAGCCCTGTGAGTAATCCTGGGG - Intergenic
1094195068 12:27740599-27740621 GTTACCTCTAAGTAGCACTGAGG + Intronic
1095981219 12:47975816-47975838 GTGACCTCTGAGGAGACCTCAGG + Intronic
1096650409 12:53059529-53059551 GAGGCCTCGGCGTAGCCCTGGGG - Exonic
1097206154 12:57322883-57322905 GAGGCCTCTGAGTACCAGTGGGG + Intronic
1098472488 12:70861666-70861688 GAGACCTTTGTTTAGTCCTGGGG + Intronic
1098828867 12:75334493-75334515 GAAAGCTCTGAGTCGCCCTCTGG - Intronic
1101547736 12:105732447-105732469 TTTACCTCTTAGTAGCCCTGGGG + Intergenic
1103936825 12:124481452-124481474 GAGACCTGTGGCTAGCCCTGTGG - Intronic
1103976533 12:124706218-124706240 CAGAGGTCTGAGGAGCCCTGAGG - Intergenic
1104274152 12:127309362-127309384 GAGCCTTCTGAGTAACGCTGAGG + Intergenic
1105946237 13:25192423-25192445 GAGACCTTCCAGAAGCCCTGTGG + Intergenic
1113908994 13:113832959-113832981 GGGACCCCCGAGAAGCCCTGTGG - Intronic
1115767844 14:36642429-36642451 GGAACCTCTGAGTAGCCCTAGGG - Intergenic
1117841258 14:59862772-59862794 GGGAACACTGAGTAGCCCTTGGG - Intronic
1121548686 14:94781731-94781753 TAGGCCTCCGGGTAGCCCTGGGG + Intergenic
1122038573 14:98965661-98965683 TAGACATCTGAGAAGTCCTGGGG + Intergenic
1122091601 14:99344362-99344384 GAGCTTTCTGAGAAGCCCTGAGG - Intergenic
1123888189 15:24748744-24748766 GAGTCCCCAGAGAAGCCCTGGGG + Intergenic
1123939392 15:25209504-25209526 GTGATCTCTGTGCAGCCCTGGGG + Intergenic
1125329264 15:38565728-38565750 GAGACCTCTGACTTGGACTGAGG + Intergenic
1125523365 15:40360264-40360286 AAAACCCCTGTGTAGCCCTGGGG + Intronic
1127360793 15:58243353-58243375 TAGAACTCAGACTAGCCCTGGGG - Intronic
1128545268 15:68562169-68562191 GACCCCTCTGTGTAGTCCTGGGG - Intergenic
1129072052 15:72959826-72959848 GAGACCCCACAGTTGCCCTGAGG - Intergenic
1130063281 15:80584702-80584724 GTGCCCTCTGTGCAGCCCTGGGG + Intronic
1130462456 15:84169107-84169129 GGGTCCTCTGAGGAACCCTGGGG + Intergenic
1130501808 15:84504436-84504458 GGGTCCTCTGAGGAACCCTGGGG - Intergenic
1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG + Intergenic
1132383412 15:101382359-101382381 GGGACCTTTGAGCAGCCCTCAGG - Intronic
1135303694 16:21351552-21351574 GAGAGCTCTTAGTAGCTCTGTGG + Intergenic
1136300436 16:29330747-29330769 GAGAGCTCTTAGTAGCTCTGTGG + Intergenic
1138304441 16:55961456-55961478 GATAGCTCAGAGTAACCCTGGGG + Intergenic
1138654893 16:58485485-58485507 TAAACCCCTTAGTAGCCCTGGGG - Intronic
1139821557 16:69725454-69725476 GTGACCTCTGAGTTCCCCTAGGG + Intronic
1140438143 16:74965618-74965640 AATCCCTCCGAGTAGCCCTGAGG + Intronic
1140745544 16:77977241-77977263 GGGACCTCTGAGAGACCCTGGGG - Intronic
1141746356 16:85929159-85929181 GAGAACTCGGCATAGCCCTGCGG + Intergenic
1142062155 16:88037512-88037534 GAGAGCTCTTAGTAGCTCTGTGG + Intronic
1142067622 16:88071921-88071943 GAGTCCTCGGTGTGGCCCTGAGG + Intronic
1142230516 16:88898036-88898058 AAGACCTCTGGGGAGGCCTGCGG + Intronic
1143733440 17:8894282-8894304 GGGACCGAGGAGTAGCCCTGCGG - Intronic
1143780207 17:9225372-9225394 GAGGGCTCAGAGGAGCCCTGCGG + Intronic
1144187329 17:12808704-12808726 AAGACCTCTGATATGCCCTGGGG + Intronic
1151364964 17:73611388-73611410 GAGGCCTCTGAGTGGCCCTGGGG - Intronic
1152806102 17:82357112-82357134 GAGCCCTCTGAGGGCCCCTGTGG - Intergenic
1153046811 18:863424-863446 GGGAACTCTGGGTAGCCTTGTGG - Intergenic
1153506313 18:5803224-5803246 AAGACCTCTGAAATGCCCTGGGG - Intergenic
1154345350 18:13539201-13539223 GAGACCTCTGGGGAGACATGGGG + Intronic
1155162060 18:23204091-23204113 GAGACTTGTGAGCAGCTCTGGGG - Intronic
1160298684 18:77659398-77659420 GAGGCCCCTGAGGAGCTCTGAGG + Intergenic
1160822848 19:1066489-1066511 GTTACCTCTCAGCAGCCCTGTGG - Intronic
1165783608 19:38447998-38448020 GAGACATTTGGGAAGCCCTGAGG + Intronic
1167698274 19:51027361-51027383 GAGGCCCCAGAGGAGCCCTGGGG - Intronic
1168018631 19:53593371-53593393 GAGGCCTCTGTGTAGGGCTGAGG + Intergenic
926359394 2:12071384-12071406 ATGACCTCTAAGAAGCCCTGGGG + Intergenic
927240802 2:20918329-20918351 GGCACCTCTGAGTGGCCCCGAGG - Intergenic
927360144 2:22223625-22223647 GAGACATCTGACATGCCCTGGGG - Intergenic
927753038 2:25686809-25686831 GAGGCCCCTGAGTAGACCTAGGG - Intergenic
929577015 2:43058236-43058258 GTGACCTTTAAGTAGCGCTGCGG + Intergenic
930878466 2:56245747-56245769 GAGACCTCTTAATAGCCATGAGG + Intronic
931747776 2:65305472-65305494 GAGACACCTGAGAATCCCTGAGG - Intergenic
934753529 2:96809676-96809698 GGGACCTCTGAGTAGCTCTGAGG + Exonic
936076387 2:109404392-109404414 CTGGCCTCTGAGTAGCCATGTGG + Intronic
936284889 2:111174114-111174136 GGGACCTCTGAGCACCCTTGGGG - Intergenic
938078934 2:128358992-128359014 GAGACTGCTCAGAAGCCCTGGGG + Intergenic
938223036 2:129587917-129587939 GAGGACTCTGAGTCGCCATGAGG - Intergenic
938251820 2:129821529-129821551 CAGACCTGTGCTTAGCCCTGGGG - Intergenic
943619976 2:190138540-190138562 GAGACTTCTCAGCAGCCATGGGG - Intronic
947432462 2:230043222-230043244 GAGTCCTATATGTAGCCCTGGGG + Intronic
947593287 2:231396585-231396607 GAGACGCCTGGGTTGCCCTGAGG - Intronic
947914415 2:233822302-233822324 GAGACCCCTGAGGAGCCTTGGGG - Intronic
948296689 2:236865745-236865767 AAGACCTCTGACATGCCCTGGGG + Intergenic
1169883754 20:10375370-10375392 GAGACTTCAGTGTAGCCATGTGG - Intergenic
1171890092 20:30703729-30703751 GAGACTTCCGTGGAGCCCTGTGG - Intergenic
1172649612 20:36493479-36493501 GAGAGTTCTGAGAAGCCCAGAGG + Intronic
1176150238 20:63587041-63587063 GAGACCTCTCAGTGGCACAGGGG - Intergenic
1177757993 21:25370473-25370495 CAGAACTCTGAGTAGGACTGTGG + Intergenic
1179887588 21:44320984-44321006 GAGCCCGCTGACTAGCTCTGGGG - Intronic
1181037859 22:20178524-20178546 GTGACCTCTGGGTGGCCCAGGGG + Intergenic
1181722403 22:24785990-24786012 AAGACCTCTAAGGAGCTCTGAGG + Intergenic
1181982866 22:26778471-26778493 AGGACATCTGAGCAGCCCTGTGG + Intergenic
1183150793 22:36035705-36035727 AAGACCTCGCAATAGCCCTGTGG - Intergenic
1183256629 22:36766605-36766627 GAGGTCACTGAGTAGGCCTGGGG + Intronic
1184382482 22:44154097-44154119 GACACCTCTGAGAAGGGCTGTGG - Intronic
1184483935 22:44765116-44765138 GTGACCTGAGAGTGGCCCTGGGG + Intronic
1185050341 22:48551026-48551048 GTGCCCTCAGAGCAGCCCTGGGG - Intronic
953869238 3:46611983-46612005 AAGAGCTCTGAGAAGCCCTCTGG - Intronic
956790859 3:72679006-72679028 GAGACCTCTGTCTTCCCCTGTGG + Intergenic
958023990 3:88028688-88028710 CAGAACTCTGTGTGGCCCTGCGG - Intergenic
960064768 3:113359346-113359368 GAGACCTCTAAGTATCCTTATGG - Intronic
962476442 3:135759211-135759233 CTGACCTGTGAGGAGCCCTGTGG - Intergenic
962971370 3:140404771-140404793 GTGACCTCAGAGGACCCCTGTGG + Intronic
964351390 3:155806453-155806475 GAGATCTCTGAGCAGCACTGTGG + Intergenic
967303364 3:188038243-188038265 TACTCCTCTGAGCAGCCCTGGGG + Intergenic
968705593 4:2075999-2076021 GAGGTCTCGGAGAAGCCCTGAGG - Intronic
969532202 4:7736339-7736361 GGGACCTGTGACTAGCTCTGAGG - Intronic
971445163 4:26736839-26736861 GAGAGCTCTGAGTGTCTCTGAGG + Intronic
972323120 4:37991129-37991151 TAAACCTCTGAGTAGCCCCTTGG + Intronic
975052605 4:69884012-69884034 AAGACCTCTGACATGCCCTGGGG + Intergenic
975606853 4:76163734-76163756 GAGGCCTTTGACTAGGCCTGAGG - Intronic
977357899 4:95969606-95969628 TAGAACTCTGTGCAGCCCTGGGG - Intergenic
979391958 4:120138420-120138442 AAGACCTCTGACATGCCCTGGGG + Intergenic
981788821 4:148512066-148512088 GAAACCTCTGAATAACCTTGAGG + Intergenic
983068238 4:163236679-163236701 GAGGCCTCTCGGTAGCCATGTGG - Intergenic
983607657 4:169608369-169608391 GAGACAACTGGGTAGCCATGTGG + Intronic
985615215 5:916034-916056 GATTCCGCTTAGTAGCCCTGGGG + Intronic
986314767 5:6579242-6579264 GGGAACTCAGAGGAGCCCTGAGG + Intergenic
987659512 5:20854734-20854756 AAGATCTCTGACAAGCCCTGGGG - Intergenic
988813416 5:34807182-34807204 AAGAACACTGAGGAGCCCTGAGG + Intronic
989122840 5:38021381-38021403 GACACTTCTGAGGAGCTCTGTGG + Intergenic
990264498 5:54061054-54061076 AAGACCTCTGACATGCCCTGGGG - Intronic
991355805 5:65767541-65767563 AAGACCTCTGACATGCCCTGGGG + Intronic
997657006 5:135562664-135562686 GCTACCTCTGTGTAGCTCTGAGG + Intergenic
997749409 5:136330094-136330116 GGGACCTTTGGGAAGCCCTGTGG + Intronic
1000052570 5:157575539-157575561 GAGACCTGGGAGTAGCCTTGCGG - Intronic
1001706975 5:173748589-173748611 GGGACCTCTGAGAAGTCATGTGG + Intergenic
1001936450 5:175709122-175709144 GATGCCACTGAGAAGCCCTGGGG - Intergenic
1002426958 5:179182156-179182178 GAGCCCTCTGTGTGCCCCTGTGG + Intronic
1002641450 5:180632440-180632462 GAGCCCTGTGAGAAGACCTGGGG - Intronic
1002961512 6:1919232-1919254 GAGACCTCTGAGGAGCAGTCAGG - Intronic
1004273532 6:14215247-14215269 GGGACCTCTGAGGAATCCTGGGG + Intergenic
1006085688 6:31593240-31593262 GAAATCTTGGAGTAGCCCTGGGG - Intergenic
1007473225 6:42104165-42104187 GAGAGATCTGAGTGGCCCTTGGG - Intronic
1007996786 6:46316055-46316077 GTCACCTCTGAGTGTCCCTGAGG + Intronic
1009452590 6:63818832-63818854 GAAACCTCCGTGTGGCCCTGTGG + Intronic
1009998717 6:70925858-70925880 CTGACCCCTGAGTAGCCCAGTGG + Intronic
1010934428 6:81844506-81844528 GAGTCCTCTGAGTCCTCCTGAGG + Intergenic
1011620838 6:89240975-89240997 GGCACCTCAGACTAGCCCTGGGG + Intergenic
1017339156 6:153300478-153300500 AGGACATCTGAGTAGCCCTTTGG + Intergenic
1017818656 6:158033099-158033121 GGGGCCTCTGGTTAGCCCTGTGG - Intronic
1023488312 7:40710755-40710777 AAAACCTCTGATGAGCCCTGGGG - Intronic
1026124593 7:67568503-67568525 GAGACCTGTGATGAACCCTGCGG - Intergenic
1027233703 7:76285938-76285960 GAGACCTCTTTGTAGCCTTGGGG - Exonic
1030344856 7:108421853-108421875 GAGACTTCTGACCTGCCCTGTGG + Intronic
1031823733 7:126535791-126535813 GAAAACTCTCAGCAGCCCTGTGG + Intronic
1032698133 7:134355369-134355391 GAGACCTCTGAGGCCCCCCGTGG - Intergenic
1034479342 7:151307740-151307762 GAGGGCCCTGAGCAGCCCTGGGG + Intergenic
1035815104 8:2530536-2530558 CTGACCTCTGAGGAACCCTGAGG + Intergenic
1036906124 8:12709772-12709794 GAGAATTCTTAGGAGCCCTGGGG - Intergenic
1039352503 8:36778808-36778830 GATACCTCTGGGTAGTTCTGGGG - Intergenic
1040986262 8:53297153-53297175 TACACCTCTGGGTAGCCATGAGG - Intergenic
1041089464 8:54288531-54288553 GAGATCCATGCGTAGCCCTGTGG + Intergenic
1041106739 8:54452398-54452420 GACACATCTGTGTAGGCCTGTGG - Intergenic
1042933623 8:74036801-74036823 AAGCTCTCTGAGTAGCTCTGTGG + Intergenic
1045035053 8:98170235-98170257 GAAACCTCCGTGCAGCCCTGGGG + Intergenic
1046359406 8:113131262-113131284 GAGATCTCTGAAATGCCCTGGGG - Intronic
1047053415 8:121138552-121138574 AAGACCTCTGACATGCCCTGGGG - Intergenic
1047196400 8:122725892-122725914 GAGACCTCTGAGAAACTGTGTGG + Intergenic
1049195981 8:141315835-141315857 GGAGCCTCTGAGCAGCCCTGTGG + Intergenic
1049486434 8:142866132-142866154 GAAACCACTGATAAGCCCTGTGG - Intronic
1051132946 9:13883115-13883137 GAGGCCTCTGAGTGGGCCTATGG + Intergenic
1051685827 9:19657333-19657355 GAGAACTGTGAGTAGATCTGAGG - Intronic
1057829894 9:98398399-98398421 GGTCACTCTGAGTAGCCCTGGGG + Intronic
1059570136 9:115425374-115425396 AAGACCTCTGACATGCCCTGTGG + Intergenic
1059635178 9:116163367-116163389 GAGACCTATGAGCAGGCCTGAGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061211418 9:129195554-129195576 CAGACCCCTGAGGTGCCCTGCGG - Intergenic
1186430637 X:9501496-9501518 GTGACCTGTGAGGACCCCTGGGG + Intronic
1189311534 X:40021829-40021851 GAGACATTTAAGTAGCCCTATGG + Intergenic
1196581516 X:117384634-117384656 CAGAGCTCTCAGTAGCACTGGGG + Intergenic
1198936429 X:141905464-141905486 GAGTCCTCAGAGTTGTCCTGAGG + Exonic
1200400198 X:156015451-156015473 GAGACACCTGAGGAGACCTGGGG - Intergenic