ID: 1067068913

View in Genome Browser
Species Human (GRCh38)
Location 10:43118749-43118771
Sequence CCGAACTGGGTGAGGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068913_1067068930 12 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068930 10:43118784-43118806 GGGGCAGGGAGCTCTAGGAATGG No data
1067068913_1067068931 26 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068931 10:43118798-43118820 TAGGAATGGACAGTGCATCCTGG No data
1067068913_1067068932 27 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068913_1067068923 -8 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068923 10:43118764-43118786 CAGTTCGGGGCTGGGCCCGTGGG No data
1067068913_1067068928 7 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
1067068913_1067068926 -2 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068926 10:43118770-43118792 GGGGCTGGGCCCGTGGGGCAGGG No data
1067068913_1067068925 -3 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068925 10:43118769-43118791 CGGGGCTGGGCCCGTGGGGCAGG No data
1067068913_1067068922 -9 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068922 10:43118763-43118785 CCAGTTCGGGGCTGGGCCCGTGG No data
1067068913_1067068924 -7 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068924 10:43118765-43118787 AGTTCGGGGCTGGGCCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068913 Original CRISPR CCGAACTGGGTGAGGACACA TGG (reversed) Intronic