ID: 1067068920

View in Genome Browser
Species Human (GRCh38)
Location 10:43118762-43118784
Sequence CACGGGCCCAGCCCCGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068920_1067068933 21 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068933 10:43118806-43118828 GACAGTGCATCCTGGGTACTAGG No data
1067068920_1067068928 -6 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
1067068920_1067068930 -1 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068930 10:43118784-43118806 GGGGCAGGGAGCTCTAGGAATGG No data
1067068920_1067068934 22 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068934 10:43118807-43118829 ACAGTGCATCCTGGGTACTAGGG No data
1067068920_1067068931 13 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068931 10:43118798-43118820 TAGGAATGGACAGTGCATCCTGG No data
1067068920_1067068932 14 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068920_1067068935 30 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068935 10:43118815-43118837 TCCTGGGTACTAGGGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068920 Original CRISPR CACGGGCCCAGCCCCGAACT GGG (reversed) Intronic