ID: 1067068926 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:43118770-43118792 |
Sequence | GGGGCTGGGCCCGTGGGGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1067068913_1067068926 | -2 | Left | 1067068913 | 10:43118749-43118771 | CCATGTGTCCTCACCCAGTTCGG | No data | ||
Right | 1067068926 | 10:43118770-43118792 | GGGGCTGGGCCCGTGGGGCAGGG | No data | ||||
1067068919_1067068926 | -10 | Left | 1067068919 | 10:43118757-43118779 | CCTCACCCAGTTCGGGGCTGGGC | No data | ||
Right | 1067068926 | 10:43118770-43118792 | GGGGCTGGGCCCGTGGGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1067068926 | Original CRISPR | GGGGCTGGGCCCGTGGGGCA GGG | Intronic | ||