ID: 1067068926

View in Genome Browser
Species Human (GRCh38)
Location 10:43118770-43118792
Sequence GGGGCTGGGCCCGTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068913_1067068926 -2 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068926 10:43118770-43118792 GGGGCTGGGCCCGTGGGGCAGGG No data
1067068919_1067068926 -10 Left 1067068919 10:43118757-43118779 CCTCACCCAGTTCGGGGCTGGGC No data
Right 1067068926 10:43118770-43118792 GGGGCTGGGCCCGTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068926 Original CRISPR GGGGCTGGGCCCGTGGGGCA GGG Intronic