ID: 1067068928

View in Genome Browser
Species Human (GRCh38)
Location 10:43118779-43118801
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068921_1067068928 -7 Left 1067068921 10:43118763-43118785 CCAGTTCGGGGCTGGGCCCGTGG No data
Right 1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
1067068919_1067068928 -1 Left 1067068919 10:43118757-43118779 CCTCACCCAGTTCGGGGCTGGGC No data
Right 1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
1067068920_1067068928 -6 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
1067068913_1067068928 7 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068928 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type