ID: 1067068932

View in Genome Browser
Species Human (GRCh38)
Location 10:43118799-43118821
Sequence AGGAATGGACAGTGCATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068929_1067068932 -4 Left 1067068929 10:43118780-43118802 CCGTGGGGCAGGGAGCTCTAGGA No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068913_1067068932 27 Left 1067068913 10:43118749-43118771 CCATGTGTCCTCACCCAGTTCGG No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068927_1067068932 -3 Left 1067068927 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068920_1067068932 14 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068921_1067068932 13 Left 1067068921 10:43118763-43118785 CCAGTTCGGGGCTGGGCCCGTGG No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data
1067068919_1067068932 19 Left 1067068919 10:43118757-43118779 CCTCACCCAGTTCGGGGCTGGGC No data
Right 1067068932 10:43118799-43118821 AGGAATGGACAGTGCATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068932 Original CRISPR AGGAATGGACAGTGCATCCT GGG Intronic