ID: 1067068933

View in Genome Browser
Species Human (GRCh38)
Location 10:43118806-43118828
Sequence GACAGTGCATCCTGGGTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068920_1067068933 21 Left 1067068920 10:43118762-43118784 CCCAGTTCGGGGCTGGGCCCGTG No data
Right 1067068933 10:43118806-43118828 GACAGTGCATCCTGGGTACTAGG No data
1067068927_1067068933 4 Left 1067068927 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
Right 1067068933 10:43118806-43118828 GACAGTGCATCCTGGGTACTAGG No data
1067068929_1067068933 3 Left 1067068929 10:43118780-43118802 CCGTGGGGCAGGGAGCTCTAGGA No data
Right 1067068933 10:43118806-43118828 GACAGTGCATCCTGGGTACTAGG No data
1067068921_1067068933 20 Left 1067068921 10:43118763-43118785 CCAGTTCGGGGCTGGGCCCGTGG No data
Right 1067068933 10:43118806-43118828 GACAGTGCATCCTGGGTACTAGG No data
1067068919_1067068933 26 Left 1067068919 10:43118757-43118779 CCTCACCCAGTTCGGGGCTGGGC No data
Right 1067068933 10:43118806-43118828 GACAGTGCATCCTGGGTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068933 Original CRISPR GACAGTGCATCCTGGGTACT AGG Intronic