ID: 1067068937

View in Genome Browser
Species Human (GRCh38)
Location 10:43118816-43118838
Sequence CCTGGGTACTAGGGTACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067068929_1067068937 13 Left 1067068929 10:43118780-43118802 CCGTGGGGCAGGGAGCTCTAGGA No data
Right 1067068937 10:43118816-43118838 CCTGGGTACTAGGGTACCCTGGG No data
1067068927_1067068937 14 Left 1067068927 10:43118779-43118801 CCCGTGGGGCAGGGAGCTCTAGG No data
Right 1067068937 10:43118816-43118838 CCTGGGTACTAGGGTACCCTGGG No data
1067068921_1067068937 30 Left 1067068921 10:43118763-43118785 CCAGTTCGGGGCTGGGCCCGTGG No data
Right 1067068937 10:43118816-43118838 CCTGGGTACTAGGGTACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067068937 Original CRISPR CCTGGGTACTAGGGTACCCT GGG Intronic