ID: 1067069074

View in Genome Browser
Species Human (GRCh38)
Location 10:43119450-43119472
Sequence AGCCAGGGGTGGGAGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067069074_1067069086 15 Left 1067069074 10:43119450-43119472 CCTGCGGCCTCCCACCCCTGGCT 0: 1
1: 1
2: 3
3: 50
4: 567
Right 1067069086 10:43119488-43119510 CTGCCTGACCCGCACGCCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 118
1067069074_1067069085 14 Left 1067069074 10:43119450-43119472 CCTGCGGCCTCCCACCCCTGGCT 0: 1
1: 1
2: 3
3: 50
4: 567
Right 1067069085 10:43119487-43119509 GCTGCCTGACCCGCACGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067069074 Original CRISPR AGCCAGGGGTGGGAGGCCGC AGG (reversed) Intronic
900145263 1:1156458-1156480 AGGCTGGGCTGGGAGGCCGTAGG + Intergenic
900160373 1:1220427-1220449 AGGGAGGGGTGGGAGGTCGCAGG + Intronic
900307826 1:2019614-2019636 ACCCCGGGGAGGGAGGACGCGGG - Intronic
900308185 1:2021072-2021094 AGCCAGGAGTGGGGGGCCTCTGG + Intronic
900409029 1:2504592-2504614 CGTCAGGTATGGGAGGCCGCTGG - Exonic
900414968 1:2530637-2530659 AGCCAGCAGTGGGAAGCCGCTGG - Intergenic
900945374 1:5828293-5828315 AAACAGGGCTGGGAGGCTGCTGG + Intergenic
900987287 1:6080512-6080534 AGCCCGGGGGTGGAGGCCGTCGG - Intronic
900997560 1:6130673-6130695 AGCCAGGGGTGGGAAGCTGCGGG - Intronic
901081566 1:6586810-6586832 GGCCAGGGTTGGGTGGCCCCAGG + Intronic
901216851 1:7559838-7559860 GGCCAGGGGAGGGGGGCCTCAGG + Intronic
901569194 1:10145666-10145688 GGCGAGGGGTGGGAGACAGCAGG - Intronic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901741554 1:11345287-11345309 AGCCTGGAATGGGAGGCCACGGG + Intergenic
901844111 1:11971243-11971265 GGCCAGGGGTGGGTGGGGGCTGG + Intronic
901919438 1:12525808-12525830 AGCCAGGGGTGGTGGGCAGAAGG + Intergenic
902200580 1:14830572-14830594 AGGCACGGCTGGGAGGCCTCAGG + Intronic
902392985 1:16116895-16116917 AGCAAGGGGTGGGAGATCCCAGG - Intergenic
902817371 1:18924008-18924030 AGCCAGACGGGGGAGGCAGCCGG + Intronic
903493084 1:23743902-23743924 TGCCCGGGGCGGGAGGGCGCTGG + Intronic
904256433 1:29257780-29257802 AGCCCAGGGTGGGAGGCAGAGGG + Intronic
904494779 1:30880408-30880430 AGGCAAGGGTGGGAGGCAGAGGG + Intronic
905124805 1:35708695-35708717 TGCCAGGGGTGGGAGGAGGAGGG + Intergenic
905793443 1:40802398-40802420 GGCCGGGCGGGGGAGGCCGCGGG + Intronic
906287200 1:44595222-44595244 AGGTAGGGGTGGGAGGCCAAAGG + Intronic
906478829 1:46187334-46187356 AGCCAGGAGTGAGAGGCCTGAGG + Intergenic
906580403 1:46930858-46930880 ACCCTGGGGTGGGAGGCAGGTGG - Intronic
906603320 1:47148030-47148052 ACCCTGGGGTGGGAGGCAGGTGG + Intronic
906778171 1:48548584-48548606 GGACAGGGAAGGGAGGCCGCAGG - Intronic
907450353 1:54542290-54542312 AGCCAGAGGCGGGAAGCTGCGGG - Intronic
907488428 1:54793052-54793074 TGCCTGGGGTGGGTGGCCTCCGG + Intronic
907548310 1:55282511-55282533 AGGTAGGGGTGGGAGCCTGCAGG - Intergenic
908386554 1:63648192-63648214 AACCATGGCTGGGAGGCCTCAGG + Intronic
909957943 1:81801779-81801801 AGCGACGGGCGGGAGGGCGCCGG - Intronic
910265696 1:85334668-85334690 AGGCATGGCTGGGAGGCCTCAGG - Intronic
912203088 1:107480571-107480593 AGGTAGGGGTGGGTGGGCGCGGG - Intronic
912726674 1:112064669-112064691 AGCCACAGGTTGGAGGCAGCAGG + Intergenic
913112794 1:115671350-115671372 AGCCAGGGAAAGGAGGCCGCAGG - Intronic
913403840 1:118465691-118465713 AACCATGGCTGGGAGGCCTCAGG - Intergenic
916534154 1:165687465-165687487 AGCCAGGGGTGGGGGGTAGAGGG + Intronic
916963887 1:169915405-169915427 AGCCGGGGGGGTGAGGTCGCTGG - Intergenic
917519363 1:175735263-175735285 AGCCAGGGGTGACAGGGCACAGG - Intronic
917804503 1:178601307-178601329 AGCCAGGAGTTCGAGGCTGCAGG - Intergenic
918606651 1:186435458-186435480 AACCAGGGATGGGAGGCCCAAGG + Intergenic
919005419 1:191892845-191892867 AGCCAGGGGTGTGAGGAAGTAGG + Intergenic
919743130 1:200992417-200992439 AGACAGGGCTGGGAGGCAGGTGG + Intronic
919752861 1:201048969-201048991 TGCCAGGGATGGGTGGCCCCAGG - Intronic
919849818 1:201665106-201665128 AACCATGGGTGGGAGGACGCTGG - Intronic
919931231 1:202222627-202222649 AGCCAGGGGTGGGACACCAGGGG + Intronic
919986189 1:202677082-202677104 AGGCATGGCTGGGAGGCCTCAGG - Intronic
920181843 1:204136979-204137001 AGCCAGGGATGGGTGTCCCCAGG + Intronic
920448614 1:206039557-206039579 AGCCCTGGGTGGGAGGCTTCTGG + Intronic
920948807 1:210553879-210553901 AGGCAGGAGTGGAAGGCAGCTGG - Intronic
920955711 1:210618739-210618761 AGCCGGGGATGGGGGGCTGCAGG - Intronic
921947151 1:220894109-220894131 AGGCAGCGGTGGGGAGCCGCAGG + Intergenic
922563488 1:226586259-226586281 AGCCAGGCGTGGGTGACCCCTGG - Intronic
922697787 1:227740251-227740273 GGCCAGGGCAGGGAGGCCGCAGG + Intronic
922913603 1:229237777-229237799 AGCCAGTGGTGGAAAGGCGCAGG + Intergenic
923713541 1:236406039-236406061 AGCCAGGGGTGGGGTGAGGCTGG - Intronic
924416723 1:243863629-243863651 AGTCAGGGGTGGGAGTCTGAAGG - Intergenic
924708420 1:246516401-246516423 ACCCATGGGTGGGGGGCAGCAGG - Intergenic
924775404 1:247112132-247112154 GCCCAGGCTTGGGAGGCCGCTGG + Exonic
1062986709 10:1775865-1775887 AGCCAGAGATGGGAAGCCACTGG - Intergenic
1063071986 10:2675947-2675969 AGCCAGGAGTGGGAGACAGAGGG - Intergenic
1063253364 10:4298931-4298953 AGCATGGGTTGGGAGGCCTCAGG - Intergenic
1063505856 10:6599034-6599056 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1064122842 10:12634489-12634511 AGCGCGGGGTGGGAGGTGGCTGG + Intronic
1065686822 10:28293934-28293956 AGCCAGAGGTGAGATCCCGCAGG + Intronic
1065993254 10:31032487-31032509 AGCCAGGGGCGGGAGCCGGAAGG - Intergenic
1066065112 10:31756237-31756259 AGGCAGGTGTGGGAGGGAGCAGG + Intergenic
1067047047 10:42990728-42990750 AGACAGGGGTGGGAGGTCTAGGG + Intergenic
1067069074 10:43119450-43119472 AGCCAGGGGTGGGAGGCCGCAGG - Intronic
1067256431 10:44647331-44647353 AGGATGGGGTGGGAGGCCGGTGG - Intergenic
1067415401 10:46098221-46098243 AGCCATGGGTAGGAGGATGCAGG + Intergenic
1067416386 10:46106334-46106356 AGGGAGGGCTGGGAGGCCACGGG + Intergenic
1067435445 10:46273297-46273319 AGCCATGGGTAGGAGGATGCAGG + Intergenic
1067438275 10:46294064-46294086 AGCCATGGGTAGGAGGATGCAGG - Intronic
1067456634 10:46423763-46423785 AGCCAGGGGTGTGGCGCCACAGG + Intergenic
1067630568 10:47960876-47960898 AGCCAGGGGTGTGGCGCCACAGG - Intergenic
1067741155 10:48897000-48897022 AGCCAGGGAAGAGAGGCCACAGG + Intronic
1067790915 10:49287054-49287076 AGACACAGGTGGGTGGCCGCTGG - Intergenic
1068169588 10:53376064-53376086 TGCCAGGGTTGGGAGGCCGGAGG + Intergenic
1069601221 10:69709460-69709482 AGCCAGGGGTGGGTAGCACCAGG + Intergenic
1069717278 10:70529361-70529383 AGATAGGGGTGGGAGGCAGCAGG - Intronic
1069884107 10:71612680-71612702 GGGCAGGAGTGGGAGGCCGGAGG + Intronic
1070257306 10:74824380-74824402 TGCCAGGGAGGGGAGGCCCCAGG - Intergenic
1070516595 10:77213933-77213955 GGCCAGGGGTGGGATGTCGGGGG - Intronic
1070842193 10:79494986-79495008 AGCCATGGGTGGGAGGGAGCAGG - Intergenic
1071042728 10:81334130-81334152 TGCCAGGCTTGGGAGGCCTCAGG + Intergenic
1071503964 10:86221945-86221967 GGCAGGGGGTGGGAGGCAGCAGG + Intronic
1073081243 10:100862323-100862345 GGTCAGGGGTGGGAGGAAGCCGG - Intergenic
1073451154 10:103610148-103610170 AGTGAGGGGTGGGAGGAAGCTGG + Intronic
1074088365 10:110225928-110225950 AGGCAGGGGCGGGAGGGGGCGGG + Intronic
1075580075 10:123610757-123610779 AGCAAGGGATGGGTGGCCCCTGG + Intergenic
1075675255 10:124291603-124291625 AGGCAGAGGTGGGAGGCCATAGG + Intergenic
1075961277 10:126569175-126569197 TGCCAGGGGTGGGTAGCCACAGG + Intronic
1076392126 10:130110870-130110892 AGGGAGGGGCGGGACGCCGCGGG + Intergenic
1076663242 10:132069247-132069269 AGCCAGGGGTGGGAGGCCAGGGG + Intergenic
1076707212 10:132308361-132308383 AGGCAGGGGAGGGAGGCCCCCGG - Intronic
1076708908 10:132320395-132320417 AGTGAGGGGTGGGGGTCCGCTGG + Intronic
1076923357 10:133467018-133467040 GGCCAGGGATGGGAGGGCACTGG + Intergenic
1077183766 11:1227571-1227593 AGGCAGGAGTGGGAGTCCTCTGG + Intronic
1077200845 11:1306785-1306807 AGGCAGGAGCTGGAGGCCGCCGG - Intronic
1077217418 11:1400763-1400785 TGTCCGGGGTGGGTGGCCGCAGG - Intronic
1077295635 11:1825149-1825171 AGGCTGGGCTGGGAGGCAGCAGG + Intergenic
1078459024 11:11499397-11499419 AGTCAGGGGTGGGAGGGCAGTGG - Intronic
1079021533 11:16913065-16913087 TGCCAAGGGTGGGAGGCCCAGGG + Intronic
1079128783 11:17735750-17735772 AGCCAGATGTGGGAGGGAGCTGG - Exonic
1083619865 11:64043532-64043554 AGCAAGGGTTAGGAGGCAGCAGG + Intronic
1083625964 11:64072131-64072153 AGCCAGGGGTGGGAGTGAGTGGG + Intronic
1083782626 11:64925992-64926014 GGGGAGGGGTGGGAGGCAGCGGG + Intronic
1083854710 11:65386981-65387003 AGCCAGGGATGGGGGGCTGGAGG - Intronic
1083858330 11:65404906-65404928 AGCCAGGCGGCGGAGCCCGCAGG + Exonic
1083879451 11:65540823-65540845 AACCCGGGGTGAGAGGGCGCGGG + Intronic
1084008641 11:66335923-66335945 AGCCAGGGGTGGGAGGGAGAGGG - Intronic
1084150340 11:67285203-67285225 AGCCAGGGATGGGAGGGCCGAGG + Intronic
1084224517 11:67707424-67707446 AGTCAAGGGTGGGAGATCGCTGG + Intergenic
1084262355 11:67987362-67987384 AGTCAAGGGTGGGAGATCGCTGG + Intergenic
1084456916 11:69273276-69273298 AGCCAGCGGTGGCAGGTCGGTGG + Intergenic
1084484362 11:69439239-69439261 GGCCAGGTGTGGGAGGTCTCAGG - Intergenic
1084954795 11:72685483-72685505 CGGCAGGGGTGGGAGGCAGCAGG - Exonic
1084958910 11:72705973-72705995 AGGCAGGGATGAGAGGCCACAGG + Intronic
1085126522 11:74006062-74006084 AGCCAGGGGCGGGGGGAAGCTGG - Intronic
1085444101 11:76589330-76589352 AGCAAGGGGTTGGAGGCAGAGGG - Intergenic
1085735012 11:79031412-79031434 AGCCAGGGTGGGGAGTCAGCAGG + Intronic
1085816352 11:79741412-79741434 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1086734345 11:90287011-90287033 ACCCAGGGGTTGGAGACCCCTGG + Intergenic
1086858205 11:91892333-91892355 AGACAGGGGAGGGAGGAAGCGGG - Intergenic
1088433489 11:109784006-109784028 TGCCTGGGGAGGGAGGCTGCAGG - Intergenic
1089054334 11:115572941-115572963 AGCAAGATGTGGGAGGCCCCAGG - Intergenic
1090230122 11:125096411-125096433 ACCCAGGTGTGGTAGGCCCCAGG - Intergenic
1090653064 11:128823967-128823989 GGCGGGGGGTGGGAGGCGGCGGG - Intergenic
1090663085 11:128895499-128895521 AGCCATGGGTGTCAGGCCCCAGG + Intronic
1091291514 11:134442918-134442940 AGCCTGCTGTGGGAGGCAGCTGG + Intergenic
1091321313 11:134654369-134654391 AGGCAGTGGTGAGAGGCCGTTGG + Intergenic
1091698585 12:2644574-2644596 AGGATGGTGTGGGAGGCCGCAGG - Intronic
1091918527 12:4286530-4286552 AGCCAGAGGAGAGACGCCGCTGG - Intronic
1092020775 12:5200666-5200688 AGCAAGAGGAGGGAGGCCGAAGG + Intergenic
1092101565 12:5888399-5888421 AGCCAGCGGTGGCAATCCGCTGG - Intronic
1092140844 12:6182471-6182493 AGGCCTGGGTGGGAGGCCCCAGG + Intergenic
1093148962 12:15599660-15599682 AGTCAGGGGTGGAAGTCTGCAGG - Intergenic
1094498786 12:31005635-31005657 AGGCAGGGGTGGGTGGGCGCAGG + Intergenic
1095122041 12:38430877-38430899 AGCCTGGGCTGGGAGGCAGAAGG + Intergenic
1095534114 12:43225265-43225287 AGCCAGCGGTGGCAACCCGCTGG + Intergenic
1095825975 12:46530980-46531002 ACCCAGAGGTGGGGGGCTGCAGG - Intergenic
1095978512 12:47956459-47956481 AAGCATGGGTGGGAGGCCTCAGG - Intergenic
1095979005 12:47959893-47959915 AAGCATGGGTGGGAGGCCTCAGG - Intergenic
1096466325 12:51849011-51849033 AGCCAGGGGCGGGAGGGGGCGGG - Intergenic
1096676854 12:53230763-53230785 AGCCAGGGGTGGGGGTGTGCCGG + Intronic
1097174774 12:57136226-57136248 GGCCAGGGGAGGGAGGCTGAAGG + Intronic
1098550753 12:71758556-71758578 ACCCAGGAGTTGGAGGCTGCAGG - Intronic
1098614545 12:72507099-72507121 AGCATGGGTTGGGAGGCCTCAGG - Intronic
1098740975 12:74172761-74172783 AGTCTGGGGTGGGAGGACTCTGG - Intergenic
1102077958 12:110074960-110074982 AGCCAGGGGTCGGGGGCGGGGGG - Intergenic
1102527101 12:113519990-113520012 AGGCAGGGGTGGGGGGGCGGAGG + Intergenic
1102963915 12:117111884-117111906 AGGCAGGGCTGGGGGGCCTCAGG - Intergenic
1103362583 12:120362556-120362578 AGCCAGAGCTGGGGGGCTGCTGG - Intronic
1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG + Intergenic
1103713351 12:122929178-122929200 AGCCAGGGGTGGGTGGACGAGGG + Exonic
1103975747 12:124701458-124701480 AGGCAGCAGAGGGAGGCCGCTGG + Intergenic
1104057243 12:125239849-125239871 TTCAAGGGGTGGGATGCCGCAGG + Intronic
1104462913 12:128969882-128969904 TGCCAGGAGTGTGAGCCCGCAGG + Intronic
1104800990 12:131555251-131555273 ACCCAGGAGTGTGAGGCAGCAGG - Intergenic
1105704763 13:22962102-22962124 AGACAGGTGTGGGAGGCCTGCGG + Intergenic
1107769725 13:43776856-43776878 AGGCACTGGTGGGAGACCGCAGG - Intronic
1109396647 13:61766864-61766886 AGCCTCAGGTGGGAGGCTGCAGG + Intergenic
1109527310 13:63593428-63593450 AGCCAGGGATGGCAACCCGCTGG + Intergenic
1109867094 13:68279193-68279215 AGCATGGCTTGGGAGGCCGCAGG + Intergenic
1111235635 13:85404424-85404446 AGACAGGGTGGGGAGGCCTCAGG - Intergenic
1112613240 13:100976518-100976540 AGCCAGCAGTGGGAACCCGCTGG + Intergenic
1113299376 13:109000395-109000417 AGGCAGATGTGTGAGGCCGCAGG + Intronic
1113781888 13:112981841-112981863 AGCCAGGGCTGGGAGGGGGCCGG - Intronic
1113793409 13:113042642-113042664 AGCCAGATGTGGGAGGCACCGGG + Intronic
1114365284 14:22019960-22019982 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1114498787 14:23153032-23153054 AGCCTTGGGTGGTAGGGCGCAGG - Intronic
1114664751 14:24370829-24370851 AGCTAGGGGTGGGAGGGTGGAGG - Intronic
1115255907 14:31401412-31401434 AGGCATGAGTGGGAGGCCTCAGG - Intronic
1116625223 14:47254825-47254847 AGGCTTGGGTGGGAGGCCTCAGG + Intronic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1118648399 14:67863899-67863921 AGGCATGGTTGGGAGGCCTCAGG + Intronic
1118777093 14:68979695-68979717 ACCCCGGGGTGGGAGGGGGCTGG + Intergenic
1118801270 14:69191847-69191869 AGGAGGGCGTGGGAGGCCGCGGG - Exonic
1119379291 14:74218420-74218442 AGCCTTGGGTGGGAGGCCAGAGG + Intergenic
1121241238 14:92431463-92431485 TGACAAGGGTGGGAGGCCACAGG + Intronic
1121242782 14:92441945-92441967 GCCCAGGGGTGAGAGGCTGCAGG + Intronic
1121311818 14:92939459-92939481 ACCCAGGGCTGGGGGGCCGGTGG - Exonic
1122022928 14:98854174-98854196 AGGCAGGGATGGGAGGCGTCAGG - Intergenic
1122075821 14:99233875-99233897 AGGCAGGGGAGGGGGGCAGCCGG + Intronic
1122230361 14:100303878-100303900 AGCTAGGGGTGGGAGAACCCGGG - Intronic
1122400048 14:101461686-101461708 AGGTAGGGCTGGGAGGCCACTGG - Intergenic
1122419097 14:101564159-101564181 AAGCAGAGGTGGGAGGCCGCTGG + Intergenic
1122549636 14:102543131-102543153 AGCCAGGGGTGGAGGGCAGAGGG + Intergenic
1122804476 14:104249687-104249709 AGCTAGGAGTGGGAGGCCAGGGG + Intergenic
1122822755 14:104355394-104355416 AGTCAGGGATGGGAGACCACGGG - Intergenic
1122900660 14:104780987-104781009 ACCCACGGGTGGGACGCGGCAGG - Intronic
1123021489 14:105399782-105399804 AGCCTGGGGTGGGAGGCACTGGG - Intronic
1123042513 14:105496178-105496200 GGCCAGGGGTGGGAGCAGGCAGG - Intronic
1123680264 15:22757918-22757940 AGCCAGCGGGGCGAGGCGGCTGG + Intergenic
1124338722 15:28876333-28876355 AGGCAGGGGAGGGAGGCCAGTGG - Intergenic
1124490254 15:30151034-30151056 GGCCAGGGAGGGGAGGGCGCAGG + Intergenic
1124753279 15:32387295-32387317 GGCCAGGGAGGGGAGGGCGCAGG - Intergenic
1124975019 15:34522995-34523017 GGCCAGGGAGGGGAGGGCGCAGG - Intergenic
1125529866 15:40406057-40406079 AGCCAAGGCTGGGTGGGCGCTGG - Intronic
1125722287 15:41851093-41851115 AGCCCGGTGTGAGAGGCTGCGGG - Exonic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1128684135 15:69671216-69671238 AGCCAGGGGTGGGATGGGGTGGG + Intergenic
1128982881 15:72199291-72199313 AGCCAGGGTTGGGAGTCCTCTGG + Exonic
1129110856 15:73336204-73336226 AGCCAGGGGTGGGAGGAGAACGG - Intronic
1129178608 15:73857444-73857466 AGGCAGAGGTGGGAGGAAGCTGG - Intergenic
1129269780 15:74413540-74413562 AGCCAGGGATGGCAGGGCACTGG - Intronic
1129323220 15:74786337-74786359 AGCCAGAGCTGGGAGGCAGGAGG - Intronic
1129696139 15:77741561-77741583 ACCCAGGAGGGGCAGGCCGCAGG + Intronic
1130986991 15:88851104-88851126 GGTCAGGGGTGGGAGGCTGGGGG - Intronic
1131499561 15:92948684-92948706 AGCCAGGCGTGGGTGGTGGCGGG + Intronic
1132064478 15:98719326-98719348 AGGCAGGGGTGGGAGGAGGAAGG - Intronic
1132073433 15:98799615-98799637 AGGCAGAGGTGGGAGGCGGCCGG + Intronic
1132295910 15:100734242-100734264 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1132413066 15:101600151-101600173 AGCCAGGGCTAGTAGGCAGCTGG - Intergenic
1132466306 16:78797-78819 GGCCAGAGGTGGGAGGCTGGCGG + Intronic
1132539161 16:500216-500238 GGCCCTGGGTGGGAGGCCTCAGG + Intronic
1132731336 16:1363709-1363731 AGACAGGTGAGGGAGGCCCCAGG + Exonic
1132748054 16:1445155-1445177 AGCCAGAGGAGGGAGGCTGAGGG + Exonic
1133218509 16:4307810-4307832 AGCCAGGGGCGGGGCGCCGCCGG - Intergenic
1133317468 16:4893409-4893431 GGCCAGGGGTGTGAGGCCCAGGG + Intronic
1133448806 16:5886114-5886136 AAGCAGGGCTGGGAGGCCTCAGG - Intergenic
1133508736 16:6437667-6437689 AGGCATGGCTGGGAGGCCTCAGG + Intronic
1133696353 16:8266702-8266724 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1134527913 16:14958435-14958457 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1135530948 16:23254019-23254041 AGCCTGGGGTGGGAGGACAGTGG + Intergenic
1136220167 16:28823413-28823435 AGGCAGGGGGAGGCGGCCGCTGG - Exonic
1136375931 16:29864942-29864964 AGCTAGGGGTGGGAGGGGTCAGG - Intergenic
1136377253 16:29872778-29872800 AGCCAGGGAGGGGAGGAGGCTGG + Intronic
1136447759 16:30334808-30334830 GGCTAGGGGAGGAAGGCCGCGGG - Intergenic
1136565374 16:31066478-31066500 ACCCAGGGGTTCGAGGCTGCAGG + Intronic
1137551691 16:49441719-49441741 AGCCTGGGTTGGCAGGCCGGTGG + Intergenic
1137619739 16:49868403-49868425 AGCTAGGGGTGCGGGGCCGCCGG + Intergenic
1137675210 16:50300713-50300735 AGGCAGGTGCGGGAGGCCACGGG + Exonic
1137717926 16:50610410-50610432 ACCCTGGGGTGGGAGGCCTCGGG - Intronic
1137743842 16:50806452-50806474 ACCCAGGCTTGGGAGGCAGCAGG + Intergenic
1138106479 16:54289604-54289626 AGCCGGGGCTGGGAGTCCGAGGG - Intergenic
1138459372 16:57138897-57138919 AGCCAAGGGAGGGAGGCACCTGG + Intronic
1138563547 16:57816340-57816362 AGCCAGGAGGGGCAGGCCCCAGG - Intronic
1139157178 16:64457712-64457734 AGCCAAGGGAGTGAGGCCTCAGG - Intergenic
1139320611 16:66111010-66111032 AGCCATGGATGGGGGGGCGCAGG - Intergenic
1140035682 16:71369602-71369624 AGCCAGGGCTGGGCGGACACAGG - Intronic
1140354210 16:74291106-74291128 AGCCAGGGATGGGAGACTACTGG - Intergenic
1140751065 16:78024380-78024402 AGGAAGGGGAGGGAGGCCCCTGG - Intronic
1141694848 16:85614395-85614417 AGCTGGGGGTGGGCGGGCGCAGG - Intronic
1142009874 16:87708509-87708531 AGGCAGGTGGGGGAGGCTGCGGG + Intronic
1142090431 16:88206918-88206940 ACGGAGGGGAGGGAGGCCGCGGG + Intergenic
1142090540 16:88207145-88207167 ACAGAGGGGAGGGAGGCCGCGGG + Intergenic
1142098692 16:88259800-88259822 ACCCTGGGGTGGGGGGCTGCAGG + Intergenic
1142100847 16:88270253-88270275 TGGCAGGGCTGGGAGGCCGAAGG - Intergenic
1142146346 16:88494445-88494467 CGGCCGGGGTGAGAGGCCGCGGG + Intronic
1142379033 16:89721464-89721486 GGCCAGGGGCGGGACCCCGCCGG - Intronic
1142711107 17:1724602-1724624 AGGGAGGGCGGGGAGGCCGCCGG + Intronic
1143108485 17:4541063-4541085 GGGCAGGGCTGGGAGGCAGCTGG - Intronic
1143330343 17:6130324-6130346 ATACTGGGGTGGGAGGCCTCAGG - Intergenic
1143382143 17:6503231-6503253 AGTGAGGGGTGGGAGGCTGGTGG - Intronic
1143522338 17:7451906-7451928 AGCCTGGTGTGGGTGGCGGCGGG - Intronic
1143781553 17:9232045-9232067 AGCCAGAGGTGGGAGGGCCTCGG + Intronic
1144222771 17:13114950-13114972 AGCCAGAGGAGAGAGGCTGCGGG - Intergenic
1144682307 17:17204175-17204197 GGCCAGAGGTGGCAGGCCGCGGG - Intronic
1144705876 17:17367543-17367565 AGCGAGGGAAGGGAGGCCGGAGG + Intergenic
1144807914 17:17979757-17979779 ACCCAGGGTTGGGAGGTGGCCGG + Intronic
1145006733 17:19342699-19342721 TCTCAGAGGTGGGAGGCCGCTGG - Intronic
1145925721 17:28645225-28645247 GGACTGGGGTGGGAGGCCGTTGG - Intronic
1146124880 17:30223726-30223748 AGCCTGGGGTGGGTGGCGGAGGG - Intronic
1146283167 17:31558507-31558529 AGCGAGGGGTGGGAGGTCAGTGG - Intergenic
1146322675 17:31859039-31859061 AGCCTGGGGCGGGAAGTCGCGGG - Intronic
1146399237 17:32490286-32490308 GACCAGAGGTGGGAGGCCCCTGG + Exonic
1146938163 17:36825574-36825596 AGGCCGGGGCAGGAGGCCGCTGG - Intergenic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1147722275 17:42546679-42546701 AACAAGGGGTGGGGGCCCGCAGG + Intergenic
1147723460 17:42552849-42552871 AACAAGGGGTGGGGGCCCGCAGG + Exonic
1147973894 17:44236775-44236797 ACCCAGGGCTGGCAGGCTGCAGG - Intergenic
1148456567 17:47814477-47814499 AGGGAGGGGTGGGAGGCGGGTGG - Intronic
1148735065 17:49860662-49860684 TCTCAGGGGTGGGAGGCCGAGGG - Intergenic
1149648102 17:58255004-58255026 AGCCAGGAGTGGGAGCCAGGTGG - Intronic
1149648186 17:58255610-58255632 AGCCAGGAGTGGGAGCCAGGCGG + Intronic
1150150973 17:62808428-62808450 AGCCAGTCGTGGGCGCCCGCCGG + Intergenic
1150904998 17:69327411-69327433 ACCCAGGCGTGGGAGGCCCTGGG - Intergenic
1151177869 17:72303454-72303476 AGCCAGAGCTGGGAAACCGCTGG - Intergenic
1151783892 17:76265789-76265811 AGCCGAGGGTCGGGGGCCGCGGG + Intronic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152331985 17:79678811-79678833 GGCCGAGGGTGGGAGGCTGCAGG - Intergenic
1152352618 17:79791920-79791942 AGGTGGGCGTGGGAGGCCGCTGG - Intergenic
1152503001 17:80725628-80725650 AGCCGGGGCTGTGAGGCTGCAGG + Intronic
1152532478 17:80927144-80927166 AGCCAGAGCTGGGAGGTGGCTGG + Intronic
1152558162 17:81064945-81064967 AGCCAAGTGTGGGTGGCTGCCGG - Intronic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1152722538 17:81929958-81929980 AGCCTGGGGCGGGAGGATGCCGG - Intergenic
1152722556 17:81930017-81930039 AGCCTGGGGCGGGAGGATGCCGG - Intergenic
1152934076 17:83125912-83125934 AGCCAGGGGTTCGAGGGCGAGGG - Intergenic
1153492569 18:5664451-5664473 AGCTATGGGTGGGAGGAAGCTGG + Intergenic
1153596682 18:6732538-6732560 AGCTAGGGATGGCAGGCAGCAGG - Intronic
1154321658 18:13359031-13359053 AGCCAGGGGTGGGATTCTGTTGG - Intronic
1155389273 18:25316425-25316447 AGCCAGGGGTGGGGGGTGGGGGG + Intronic
1156345582 18:36253978-36254000 AGGCACAGGTGGGAGGCAGCTGG + Intronic
1157161500 18:45318148-45318170 TTCCAGGAGTGGGAGGCAGCTGG + Intronic
1157586636 18:48805333-48805355 AGCCATGGGGGCCAGGCCGCAGG + Intronic
1157620316 18:49013371-49013393 AGTCAGGCTGGGGAGGCCGCAGG + Intergenic
1157820543 18:50765127-50765149 AACCATGGTTGGGAGGCCTCAGG + Intergenic
1158832535 18:61296029-61296051 AGCCAGGGGTGGGGGGTAGTGGG + Intergenic
1158954369 18:62524409-62524431 AGCGAGGCCGGGGAGGCCGCCGG - Intronic
1160247288 18:77169106-77169128 AGCCAGGGGTGGCTGGCCTGAGG + Intergenic
1160377853 18:78427458-78427480 AGCCAGGGGTTGGAGGCCCAGGG - Intergenic
1160772524 19:839366-839388 AGCTGGGGGAGGGAGGCCGGGGG + Intergenic
1160791939 19:927204-927226 AGGCAGGGGTGGGGGGCGGAGGG - Intronic
1160904338 19:1445437-1445459 AGTGAGGGCTGGGAGGCCCCGGG - Intergenic
1161266692 19:3367496-3367518 GGCCAGGGGTGAGAGGCTACGGG - Intronic
1161927607 19:7312900-7312922 AGGCAGGGGTGGGAGGTCTTGGG - Intergenic
1162030771 19:7916418-7916440 AGCCAGGGGCCGGGCGCCGCGGG - Exonic
1162534080 19:11253018-11253040 AGGCAGGGGTGGGTGCGCGCTGG + Intronic
1163303816 19:16464595-16464617 AGCCAGAGCTGAGAGGCTGCAGG - Intronic
1163520422 19:17788382-17788404 AGGCTGGGGTGGGAGGCCCCAGG - Exonic
1163584858 19:18157951-18157973 AGCCAGGGCTGGGAGGGGGCTGG + Intronic
1163747217 19:19055681-19055703 ACCCACGGAGGGGAGGCCGCAGG + Intronic
1164443753 19:28299915-28299937 TCCCAGGTGTGGGAGGCTGCTGG + Intergenic
1164535763 19:29085364-29085386 ATCCAGGGGAGGGAGGCTCCTGG + Intergenic
1165094675 19:33403583-33403605 AGCCAGGGGGTGGAGGACCCTGG + Intronic
1165150872 19:33759442-33759464 AGCCTGGGGTGGGATCCCGGTGG + Intronic
1165255867 19:34576999-34577021 GGGGAGGGGTGGGAGGCCGAAGG + Intergenic
1165794524 19:38511217-38511239 ACCCAGGAGTTGGAGGCTGCAGG + Intronic
1165860888 19:38908775-38908797 AGGCTGGGGTGGGAGGCAGCCGG - Exonic
1165890898 19:39111725-39111747 TGGCAGGGCTGGGAGCCCGCAGG - Intergenic
1165940777 19:39413714-39413736 AGCCGTGGGCGGGAGGCCGCGGG - Intronic
1166067417 19:40367913-40367935 GGCAGGGGGTGGGAGGCAGCGGG + Intronic
1166368145 19:42287480-42287502 AGACAGGTGTGGGTGGCCACGGG - Intronic
1167071480 19:47224547-47224569 ACCCAGGAGTTGGAGGCTGCAGG + Intronic
1167199211 19:48052504-48052526 AAGCATGGGTGGGAGGCCTCAGG - Intronic
1167618681 19:50549654-50549676 AGGGAGGGCTGGGAGGCAGCAGG + Intronic
1167910872 19:52700735-52700757 AGCCGGGGGTGGGAGGGCATGGG + Intergenic
925155734 2:1647954-1647976 AGCCAGGGGTGGATGGACGGTGG - Intronic
925388936 2:3482642-3482664 AGCCAGGGTTGGGAGCCCTGGGG - Intronic
926055389 2:9771284-9771306 ACCCTGGGGTGGGAGGCCCCAGG - Intergenic
926456627 2:13074976-13074998 AGCCTGGCTTGGGAGGCCTCAGG + Intergenic
926545635 2:14235927-14235949 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
927683210 2:25153823-25153845 AGACAGGGGTGAGAGGACTCAGG - Intronic
927873683 2:26640367-26640389 AGGCAGGGATGGGAGGGCCCAGG - Intronic
928097525 2:28413568-28413590 AGGCAGGGGAGGGAGGCGGGAGG + Exonic
928394306 2:30932002-30932024 AGCCAAGGCTGGGCGGCTGCTGG - Intronic
928993038 2:37255859-37255881 AGCCAGGTGTGGGTGGCCCATGG + Intronic
929587872 2:43127368-43127390 GGCCAAGGATGGGAGGCGGCTGG + Intergenic
929795185 2:45053762-45053784 AGCCAGGGTGGGGAGTCCTCAGG - Intergenic
930188245 2:48431513-48431535 TGCCAGGGGTGGGGGGCAGGAGG + Intergenic
930369609 2:50486609-50486631 AGCCAGTGGTGAGAGGCCTAAGG + Intronic
930966508 2:57335314-57335336 AGCCAGCAGTGGCAGCCCGCTGG + Intergenic
931223557 2:60309927-60309949 AGGCAGTGGTGGGAGGCAGCAGG + Intergenic
932238040 2:70136756-70136778 AACAAGGGGTGGGAGGCAGGAGG - Intergenic
932279649 2:70479350-70479372 AGTCAGTGGTGGGAGGCCTATGG - Intronic
932301100 2:70667473-70667495 AGCCAGTGGTTGGAGGCTGTGGG - Intronic
932356693 2:71073334-71073356 AGCCAGGGGTGGCAGGGGGTGGG - Intronic
932667428 2:73708483-73708505 AGCCAGGGGTGGGGGAGCACAGG - Intergenic
934662639 2:96151301-96151323 GGGCAAGGGTGGGAGGCCGATGG - Intergenic
935896716 2:107746929-107746951 AGCCAGCAGTGGGAACCCGCTGG - Intergenic
937216945 2:120318830-120318852 AGGCAAGGTGGGGAGGCCGCAGG + Intergenic
937619666 2:123971071-123971093 ATTCAGGGGTGGGAGGCAGGTGG + Intergenic
938299045 2:130197408-130197430 AGCCAGGGGTTCAAGGCTGCAGG + Intronic
938457676 2:131477112-131477134 AGCCAGGGGTTCAAGGCTGCAGG - Intronic
939990989 2:148876368-148876390 AGCCAGGCGTGAGAGGAAGCGGG - Intronic
940948643 2:159646746-159646768 AGCCAGGGGTTGGGGACCCCTGG + Intergenic
942398408 2:175576301-175576323 AGCCAGGGTTGGGAGCCCCTGGG - Intergenic
943519104 2:188925295-188925317 AGTCATGGCTGGGAGGCCTCAGG - Intergenic
944666458 2:201963169-201963191 GGCCAGGAGTGGGAGCCAGCGGG + Intergenic
945225604 2:207529467-207529489 AGCCCGGGCTGGGACGCGGCCGG - Intergenic
946409151 2:219507822-219507844 AGGCAGGGGTGGCAGGCAGCAGG + Intergenic
946422099 2:219570901-219570923 AGCTCGGGGTCGGAGGCCGGCGG + Exonic
947119525 2:226800159-226800181 AGCCCCGAGTGGGAGGCCGGGGG + Intergenic
948186548 2:236026007-236026029 AGCCAGGGATGGGAGGTGGCAGG - Intronic
948729192 2:239952613-239952635 ATCCAGGGGAGGGAGGCCTCTGG - Intronic
949026706 2:241769809-241769831 AGGCTGAGGTGGGAGGCCGCTGG - Intergenic
1168898020 20:1337200-1337222 AGCCAGGGGTGGGGAGGCTCAGG + Intronic
1169205701 20:3739435-3739457 CCGCAGGGGTGGGAGGCCGGAGG + Intronic
1170984416 20:21244725-21244747 AGCCAGGGTTTGGAGGCTGGTGG - Intronic
1171961557 20:31498369-31498391 AGCCAAGGGTGAGATGCCGTGGG - Intergenic
1172063876 20:32206447-32206469 CCCCAGGAGTGGGAGGCAGCAGG - Intronic
1173305308 20:41841993-41842015 AGGCAGGTCTGGGAGGCCTCAGG + Intergenic
1174138607 20:48397737-48397759 AGCCAGTGGTGGGGGGGTGCGGG + Intergenic
1174615002 20:51828828-51828850 AGGCAGGGCTAGGAGGCGGCGGG + Intergenic
1175270927 20:57733762-57733784 AGTCAGGGGTGGGACGAGGCAGG - Intergenic
1175831069 20:61965785-61965807 AGCCAGGGGCGGGGGGCCCGGGG - Intronic
1175953917 20:62598478-62598500 GGACAGGGGTGGGAGGACACAGG + Intergenic
1176099838 20:63359963-63359985 ACCCAGGGGTGGGAGAGAGCCGG - Intronic
1176293089 21:5056448-5056470 AGCCTGGGCTGGGAGCCTGCAGG + Intergenic
1176669382 21:9718157-9718179 AGCCAAGGGTGGGAGTCAGTAGG + Intergenic
1177427213 21:20939198-20939220 AGGCATGGCTGGGAGGCCTCAGG + Intergenic
1178296717 21:31416244-31416266 AGCCAGAGTTGGGAGGCATCGGG - Intronic
1178417084 21:32412720-32412742 AGCCTGGGCAGGGAGGCGGCGGG + Exonic
1178581090 21:33839330-33839352 GGCCAGGGGAGGGTGGCTGCAGG + Intronic
1179362766 21:40727923-40727945 ACCCAGAGGTGGGAGCCTGCAGG - Intronic
1179800872 21:43810983-43811005 AGCAAAGGGTTGGAGGCCCCGGG - Intergenic
1179864171 21:44207202-44207224 AGCCTGGGCTGGGAGCCTGCAGG - Intergenic
1179924497 21:44526844-44526866 AGCCATGGGTGGGACCTCGCAGG - Intronic
1180064454 21:45405512-45405534 AGCCAGGGCGGCGAGGCCGGCGG - Intronic
1180118188 21:45725865-45725887 AGGAAGGGGTGGGGGGCAGCTGG + Intronic
1180179474 21:46111593-46111615 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179500 21:46111655-46111677 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179526 21:46111717-46111739 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179552 21:46111779-46111801 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179578 21:46111841-46111863 TGCCAGGGGTTGGGGGCCGGGGG + Intronic
1180977972 22:19860932-19860954 AGCCAGGGCAGGGAGGTGGCTGG + Intergenic
1181038940 22:20182900-20182922 AGGCAGGGGTGGGAGGGCCCTGG + Intergenic
1181162537 22:20966854-20966876 AGGGTGGGGTGGGAGGCCACAGG + Intronic
1181283928 22:21738969-21738991 AGGCGGGGGTGGCAGGCTGCAGG - Intergenic
1182425406 22:30268947-30268969 AGCCAGGGGAGAGAAGCCGCTGG + Intergenic
1183314224 22:37128317-37128339 CTCCTGGGGTGGGAGGCCCCAGG + Exonic
1183619065 22:38962180-38962202 AGCCCTGAGTGGGAGGCTGCGGG + Exonic
1183624268 22:38992116-38992138 AGCCCTGAGTGGGAGGCTGCGGG + Exonic
1184196670 22:42934488-42934510 AGCCAGAGTGGGGAGGCCCCAGG - Intronic
1184230627 22:43156530-43156552 GGCCAGGGGTGGGAGGGAGGGGG + Intronic
1184471618 22:44699213-44699235 AGCCCGAGGTGGGAGGCAGGAGG - Intronic
1184555633 22:45231482-45231504 AGGCAGGGGTGGGAAGCCAGAGG + Intronic
1184729526 22:46365083-46365105 AGCCTGGGGTGGGGGGACTCTGG - Intronic
1184880497 22:47301228-47301250 ACCCAGGGCTGGCAGGCCCCAGG - Intergenic
1184937744 22:47737289-47737311 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1184986623 22:48140365-48140387 AGCCAGGGGTGGGAGTGAGAGGG + Intergenic
1184999996 22:48239507-48239529 AGCTGGGGTTGGGAGGCAGCAGG + Intergenic
1185074839 22:48677638-48677660 GCTCAGGGGTGGGAGGCCTCGGG - Intronic
1185324364 22:50218448-50218470 AGCCAGGGGTGCGGGGCGCCGGG + Intronic
949105477 3:197067-197089 TGTCAGGGGTGGGGGTCCGCTGG + Intronic
949105807 3:198167-198189 GGGAAGGGGTGGGAGGCCGGCGG + Intronic
950570744 3:13798536-13798558 AGCCACGGGTGGCAGGAGGCTGG - Intergenic
951039989 3:17979408-17979430 AGCAAGGGATGGGAGGCCAGGGG - Intronic
952908915 3:38165729-38165751 AGCCACGGGTCGGACGGCGCCGG - Exonic
953030649 3:39177753-39177775 GGCCAGGGGCGGGAGGCGGGAGG - Intergenic
953232345 3:41076128-41076150 AGGCAGGGGTGGGAGGACTTGGG + Intergenic
953771388 3:45780687-45780709 AGAGAGGGGTGGGAGGCAGCAGG + Intronic
953902854 3:46853003-46853025 AGAGAGGGGTGGGAGGGGGCAGG - Intergenic
954117810 3:48476847-48476869 AGCCTGGGGCAGGAGGCAGCAGG + Intronic
954259932 3:49431307-49431329 GGCCAGGTGTGGGAGGCAGGAGG - Intergenic
954332240 3:49897245-49897267 AGGCAGGCATGGGAGGCCGCAGG - Intronic
954684420 3:52362630-52362652 AGCCATGGAGGGGAGGCCTCAGG + Intronic
954779083 3:53046097-53046119 AGCTGGGGGTGGGGGGGCGCGGG - Intronic
954886770 3:53881901-53881923 GGCAAGGGGCGGGAGGCGGCGGG - Intronic
956792624 3:72691990-72692012 ATTAAGGGGTGGGAGGGCGCAGG - Intergenic
957077757 3:75615183-75615205 AGTCAAGGGTGGGAGATCGCTGG + Intergenic
957209293 3:77239509-77239531 AGCCAGCAGTGGGAAGGCGCTGG - Intronic
960658644 3:120033865-120033887 AAGCATGGGTGGGAGGCCTCAGG - Intronic
961057345 3:123800160-123800182 AGCCAGGGGTGGAAGCTCACAGG + Intronic
961135204 3:124503623-124503645 AGCCAGAGGTGGGGAGCTGCAGG - Intronic
961210140 3:125119311-125119333 AGGCTGGGGTGTGAGGCTGCGGG - Intronic
961646829 3:128397221-128397243 TGCCATGGGTGGGGGGCAGCAGG - Intronic
961683869 3:128616724-128616746 TGCCAGCGGTTGGGGGCCGCAGG - Intergenic
963434497 3:145250599-145250621 TGCCAGGGGTGGAAGGCGGGTGG + Intergenic
965622541 3:170655701-170655723 AGCCAGAGGTGGGAGGAGGAGGG - Intronic
967721457 3:192820632-192820654 AGCCCGGGGCGGGACGCCGGAGG - Intronic
968313985 3:197706978-197707000 AGCCAGGGCTGGGCAGCCGTGGG + Intronic
968574236 4:1357599-1357621 AGCCATGGCTGGGAGCCTGCAGG - Intronic
968789183 4:2647679-2647701 GGCCAGGGGTGGGAAGCGGGGGG - Intronic
968882281 4:3307357-3307379 AGCCTGGGGTGGGATGCTGTGGG + Intronic
969629547 4:8328449-8328471 AGCGAGGGGTGGGAGCCACCGGG - Intergenic
969661759 4:8534161-8534183 AGGCAGGGGTGGAAGGAGGCAGG + Intergenic
969733013 4:8968233-8968255 AGTCAAGGGTGGGAGATCGCTGG - Intergenic
969792589 4:9502311-9502333 AGTCAAGGGTGGGAGATCGCTGG - Intergenic
970616859 4:17775839-17775861 CTCCAAGGGTGGGAGGCTGCAGG + Intronic
971230929 4:24799885-24799907 AGCCAGGGCTGCGAGTCCACCGG + Exonic
973978323 4:56285027-56285049 AACCATGGTTGGGAGGCCTCAGG + Intronic
976570504 4:86602837-86602859 AGCCAGGTGTGTGTGGCAGCAGG - Intronic
978013734 4:103719461-103719483 GCCCAGGGCTGGGAGGGCGCGGG + Exonic
979781012 4:124651216-124651238 AGCCAGGAGTGGCAACCCGCTGG + Intergenic
981094481 4:140764207-140764229 GGCCAGGGGTTCGAGGCCACGGG + Intergenic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
984824995 4:183916175-183916197 GGCCAGGGGTGGCAGCCGGCAGG + Intronic
985405388 4:189633311-189633333 AGCCAAGGGTGGGAGTCAGTAGG - Intergenic
985620440 5:952213-952235 AGCCAGGGGAGGGAGGTGGGGGG - Intergenic
985629932 5:1008981-1009003 AGCCGGGGCCGGGAGCCCGCGGG - Exonic
985890884 5:2714619-2714641 AGGCAGGGGTGGGAGACCCATGG + Intergenic
987827144 5:23046440-23046462 AGGCATGGTTGGGAGGCCTCAGG - Intergenic
988797978 5:34669546-34669568 AGGCTCGGGTGGCAGGCCGCTGG + Intronic
988914406 5:35877870-35877892 AGCCAGGGTTTGGAGGCCTGTGG - Exonic
990277723 5:54215788-54215810 AGTCAGGGGTGGGGGGCTGGGGG + Intronic
993776507 5:92005384-92005406 AGCCAGGGTTGGGAGGGCACAGG + Intergenic
997962987 5:138336892-138336914 AGCCAGGGAGGGGAGGAGGCAGG - Intronic
998192822 5:140042146-140042168 TGCCAGGGGTGGGGGGCGGAGGG - Intronic
998262141 5:140639607-140639629 AGGCAGGTGTGGGCGGCCGAGGG + Exonic
999045068 5:148458634-148458656 AGCCAGGGTGGGGAGGATGCAGG + Intronic
999141742 5:149367045-149367067 GCCCAGGGCTGGGAGGCCGGGGG - Intronic
999162119 5:149510344-149510366 GGCCAGGAGTTGGAGGCCACAGG - Intronic
1000211428 5:159109661-159109683 TGCCAGGGGTGGGATGCTGATGG - Intergenic
1002135027 5:177102141-177102163 AGCCAAGGGATGGAGGCTGCTGG + Intergenic
1002182998 5:177441194-177441216 AGCCAGGGGTGGGGGACAGGCGG - Intronic
1002352196 5:178590672-178590694 AGCCAGGGGTGGGCTGCAGAAGG - Intergenic
1002925892 6:1605402-1605424 AGCCGAGGTTGGGAGGCTGCGGG + Intergenic
1003595240 6:7468738-7468760 AGCCATGGGTGGGAGTGCCCGGG - Intergenic
1003833417 6:10040473-10040495 AGTCAGCGGTGGCAGGCTGCTGG + Intronic
1004350580 6:14886981-14887003 AGGCAGGAGTTGGAGGCTGCAGG + Intergenic
1005996476 6:30934387-30934409 GGCCAGGTGGGGGAGCCCGCAGG + Intergenic
1006083830 6:31582375-31582397 GGGCAGGGGTGGGAGGCTCCAGG - Exonic
1006678827 6:35782571-35782593 AGGCAGGAGGGGGAGGCAGCCGG + Intronic
1006835995 6:36999173-36999195 AGCCAGGGATCGGAGGCCCTTGG + Intergenic
1007174379 6:39886113-39886135 AGCCTGGGGTGGGAGAACTCAGG + Intronic
1007512363 6:42383427-42383449 AGCCAGGGTTGGGAGGAGGAAGG - Intronic
1007738270 6:43995321-43995343 GGCCTGGGGTGGGTGGCTGCAGG - Intergenic
1011686561 6:89828703-89828725 AGCCAGGGGTGGCCGGGCGTGGG + Intergenic
1017158310 6:151341886-151341908 AGCCTGGGCTGGGATGCCACGGG - Intronic
1017444329 6:154493680-154493702 AGGCATGGCTGGGAGGCCTCAGG + Intronic
1017631121 6:156397236-156397258 AGCCAGGTGTGCGAGGCCGAGGG + Intergenic
1017818078 6:158029205-158029227 GGCCAGGGGTGGGGGGTGGCAGG - Intronic
1017998802 6:159560190-159560212 AGCAAGGGGTGGAACGCAGCAGG - Intergenic
1018795565 6:167182669-167182691 AGGCAGAGGTGGGTGACCGCTGG - Exonic
1018820754 6:167372394-167372416 AGGCAGAGGTGGGTGACCGCTGG + Exonic
1018895931 6:168016962-168016984 TGCCAGAGGTGAGAGGCCGTGGG - Intronic
1018986682 6:168643194-168643216 AGCCAGCTGTGGGAGGACCCAGG - Intronic
1019334648 7:477221-477243 CGCCCAGGGTGGGAGGCAGCTGG - Intergenic
1019547849 7:1587051-1587073 AGCCCAGCCTGGGAGGCCGCAGG - Intergenic
1019622124 7:1997716-1997738 GGGCAGGGGAGGGAGGCCACTGG + Intronic
1019701584 7:2476970-2476992 AGCCAGTGGGGGCAGGCGGCGGG - Intergenic
1020097574 7:5377313-5377335 AGGGAGGGGTGGGAGGGGGCGGG - Intronic
1020308266 7:6851215-6851237 AGTCAAGGGTGGGAGATCGCTGG + Intergenic
1020411351 7:7895290-7895312 TGGCAGGGGTGGGAGGCAGCTGG + Intronic
1020541938 7:9469603-9469625 AGGCATGGGTGGGAAGCCTCAGG - Intergenic
1021276994 7:18663784-18663806 AGCCAGGTGAAGGAGGCTGCAGG - Intronic
1022127521 7:27372625-27372647 AGCCAGGGGAGGAAGGCCTGAGG + Intergenic
1022265602 7:28751189-28751211 AGCCAGGGGTGGGGGGTGGGGGG + Intronic
1023632807 7:42180420-42180442 AGCCAGGGGAAGGTGGCAGCTGG + Intronic
1023688579 7:42763072-42763094 AGCCTGGTTTGGGAGGCCTCAGG + Intergenic
1023870386 7:44260253-44260275 AGCCAGAGGAGGGAGGGCACTGG - Intronic
1024054619 7:45652020-45652042 AGGCATGGCTGGGAGGCCTCAGG + Intronic
1024607441 7:51034087-51034109 GGCCAGTGGTGGGAGGGAGCTGG - Intronic
1024888830 7:54178535-54178557 AGCCAGGGATTGGAGGCCATTGG + Intergenic
1024983334 7:55175486-55175508 AGCCAGTGGTGGGAAGATGCTGG + Intronic
1025106479 7:56175213-56175235 AGCCGGGGGTGGGGGGGGGCGGG + Intergenic
1025776998 7:64568961-64568983 AGCCAGAGGTGAGAGGCAGTAGG + Intergenic
1026024249 7:66732290-66732312 AGCAGGGGGTGCGAGGCCTCTGG + Intronic
1026781750 7:73272768-73272790 ACTCAGGGGTGGGAGGCAGGAGG - Intergenic
1026828313 7:73597133-73597155 AGCCTGGGGAGGGAGGCCAGGGG - Intronic
1026882724 7:73917833-73917855 GCCCAGGGGTTGGAGGCTGCAGG - Intergenic
1027022599 7:74826202-74826224 ACTCAGGGGTGGGAGGCAGGAGG - Intronic
1027065413 7:75119707-75119729 ACTCAGGGGTGGGAGGCAGGAGG + Intronic
1027269313 7:76511434-76511456 AGCCAGGAGTGGGGAGCAGCGGG - Intronic
1027320024 7:77005329-77005351 AGCCAGGAGTGGGGAGCAGCGGG - Intergenic
1027868249 7:83674308-83674330 AGCCAGCAGTGGCAAGCCGCTGG + Intergenic
1028438434 7:90831235-90831257 AGCAAGGGTGGGGAGGCCTCAGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1030594350 7:111519275-111519297 AGCCAGGACTTGGATGCCGCTGG - Intronic
1031301298 7:120064409-120064431 AGGCATGGCTGGGAGGCCTCAGG - Intergenic
1032344451 7:131106212-131106234 AGCCGGGGGCGGCGGGCCGCCGG - Intergenic
1032525688 7:132577052-132577074 GGCCGGGGCTGGGGGGCCGCGGG + Exonic
1033587963 7:142788170-142788192 AGGCAGGAGTGGAAGGCAGCAGG + Intergenic
1033952532 7:146802673-146802695 AACCAGGGCTGGGAGGCCTCAGG - Intronic
1034676949 7:152898716-152898738 AGCCGGGGGTGGGGGGCAGCTGG + Intergenic
1035040312 7:155922069-155922091 AGCCAGGCTTGCAAGGCCGCTGG + Intergenic
1035299551 7:157887967-157887989 TGCCAAGGGTGGGAGGCAGGGGG - Intronic
1035754961 8:2023956-2023978 GGCCAGGAGGGGGAGGCGGCCGG + Intergenic
1038447530 8:27614497-27614519 AGCCAGGGAGGGGAGGTGGCCGG - Intronic
1038616968 8:29104195-29104217 AGCCAGGTTTGGGAGCCCGAGGG - Intronic
1039400619 8:37265986-37266008 AGGCAAGGCTGGGAGGCCGGTGG + Intergenic
1039885418 8:41651432-41651454 AGCCTAGGGTGGGAGCCTGCTGG + Intergenic
1039903100 8:41767077-41767099 AGCCGGGGTTGGGAGGCAGCGGG - Intronic
1040567797 8:48582655-48582677 AGCCAGGGGTGGGAGGCCGGTGG + Intergenic
1041354956 8:56990694-56990716 AACCAGGGGTGGGATGCTACTGG - Intronic
1045296118 8:100872896-100872918 GGGGTGGGGTGGGAGGCCGCAGG + Intergenic
1046883052 8:119331573-119331595 AGCAAGGCTTGGGAGGCCTCAGG + Intergenic
1047510475 8:125511882-125511904 AGCCAGTGCTGGGATGCAGCAGG + Intergenic
1048439595 8:134450262-134450284 AGCCAGGGATGGGTGGACTCTGG + Intergenic
1048872592 8:138811855-138811877 TGCCTGGGGTGGGAGGCCGCTGG + Exonic
1049222529 8:141434497-141434519 GGGCAGGGGTGGGAGGGTGCGGG + Intergenic
1049257601 8:141622296-141622318 AGCAAGGGCTGGGAGGAAGCTGG - Intergenic
1049268338 8:141681385-141681407 GGCCTGGGGTGGGAGCCCGCAGG - Intergenic
1049420650 8:142515081-142515103 AGCCATTGGTGGGAGGGGGCCGG + Intronic
1049421248 8:142517578-142517600 AGCGAGGGGTGGGAGGGGGAGGG + Intronic
1049746496 8:144265398-144265420 TGCCAGGGGAGGGAGCCCGTGGG - Intronic
1049755495 8:144309655-144309677 AGGCTGGGGTGGGAGCCCTCAGG - Intronic
1049780335 8:144425922-144425944 ACTGAGGGGTGGGAGGACGCAGG - Intronic
1049788043 8:144460537-144460559 AGCCAATGGTGTGAGGCCACGGG - Intronic
1049830708 8:144699445-144699467 AGGCGGGGGTGGGAGGCTGTGGG + Intergenic
1050952862 9:11618856-11618878 AATGAGGGCTGGGAGGCCGCAGG - Intergenic
1053159976 9:35807152-35807174 AGCCATGGGTGAGAGGTGGCGGG + Intronic
1053319160 9:37080061-37080083 AGGCAGGGGTCCCAGGCCGCGGG - Intergenic
1054913616 9:70476340-70476362 ATCCAGGGGTGGAAGGAGGCTGG - Intergenic
1055637135 9:78290025-78290047 AGGCATGGCTGGGAGGCCTCAGG + Intergenic
1056137921 9:83647485-83647507 AGCCAGGGGTGGGAGCCTCAGGG + Intergenic
1056259495 9:84833648-84833670 AGGCAGGGGAGGGAGGGGGCAGG + Intronic
1056617430 9:88180504-88180526 AGCCAGGGGTTCGGGGCAGCAGG - Intergenic
1056832753 9:89930102-89930124 GGCCAGAGGTGGGAGGCACCTGG - Intergenic
1056977517 9:91272523-91272545 AGACAGAGGTGGGAGGGTGCTGG - Intronic
1057067330 9:92067426-92067448 AGCAAGGGCTGGCAGGCCCCAGG - Intronic
1057226824 9:93296966-93296988 AGCCAAGGGGAGGAGGCCGAGGG - Intronic
1057234283 9:93346360-93346382 AGCCACGGAGGGGAGGCGGCCGG + Exonic
1057550517 9:96048438-96048460 AAGGAGGGGAGGGAGGCCGCTGG + Intergenic
1059642672 9:116232942-116232964 TGTCAGGGGTGGGAAGCCACAGG - Intronic
1060087235 9:120714083-120714105 AGCCAGGGGTCGGTGGACGGTGG + Exonic
1060104975 9:120868024-120868046 AGGCAGGGGTAGGGGGCCGGGGG - Intronic
1060107447 9:120882095-120882117 AGCCAGGTGTGGCAGGCATCAGG + Intronic
1060224837 9:121784363-121784385 AGGCAGCGGTGGGAGGGGGCTGG - Exonic
1060421303 9:123471587-123471609 TGCTAGGGCTGGGACGCCGCAGG + Intronic
1060796236 9:126514575-126514597 CGCAGGGGGTGGGAGGCCGGCGG - Intergenic
1060970537 9:127735076-127735098 AGCGAGGGGCGGGCGGACGCGGG - Intronic
1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG + Intergenic
1061285694 9:129621211-129621233 CACCAGGGCTGGGAGGCTGCTGG - Intronic
1061290759 9:129649236-129649258 AGCCTGGGACGGGATGCCGCAGG + Intergenic
1061665853 9:132160979-132161001 AGGCAGGTGTGGGAGGGCTCCGG - Intergenic
1061680802 9:132241665-132241687 GGGCAGCGGTGGGAGGCAGCCGG + Intronic
1061807022 9:133142351-133142373 GGCCAGGGGTGGGTGTGCGCTGG + Intronic
1061920831 9:133781482-133781504 GGTCAGGGGTGGGGGGCAGCTGG + Intronic
1062049197 9:134438460-134438482 AGGCAGGGGTGGAGGGCGGCGGG - Intronic
1062482624 9:136759467-136759489 AGGCAGGGGTGAGAGGCCCTGGG - Intergenic
1062483165 9:136761907-136761929 ACCCAGGGGTTGGGGGCTGCGGG - Intronic
1203376702 Un_KI270442v1:382775-382797 TGGCAGGGGAGGGAGGCCTCTGG + Intergenic
1203656485 Un_KI270753v1:2779-2801 AGCCAAGGGTGGGAGTCAGTAGG - Intergenic
1185449660 X:275582-275604 AGCCCGGGGTGGGAGACAGCGGG + Intergenic
1187010248 X:15271093-15271115 ACCCAGGGGTGTGAGGCAACTGG - Intergenic
1187098588 X:16170140-16170162 AGGCAGGGCTGGCAGGCTGCAGG + Intronic
1187281559 X:17861332-17861354 ACCAAGGGGTGGGAGGAGGCGGG + Exonic
1188110414 X:26191947-26191969 AGCCAGGTTTAGGAGGCCCCAGG + Intergenic
1189228308 X:39432132-39432154 TGCCAGGGAGGGGAGGCCTCTGG + Intergenic
1189321520 X:40090325-40090347 AGCCAGGGGTGGCCGGCCTGCGG - Intronic
1190108388 X:47574361-47574383 GGCCAGTGGCGGGAGGCCCCGGG - Exonic
1190113235 X:47608723-47608745 AGCCTGGGGGAGGAGGCCACCGG - Intronic
1190279331 X:48918915-48918937 AGCCAGGGCTGGGGGGCGCCAGG + Exonic
1191846487 X:65551157-65551179 AGCCAGGCGGCGGAGCCCGCAGG - Intergenic
1195208826 X:102630777-102630799 AACCAGGGAAGGGAGGCCTCAGG + Intergenic
1198806710 X:140501619-140501641 AGCATGGGGTGGGAGGGGGCCGG - Intergenic
1198956584 X:142137924-142137946 AGGCAGGGGTGGGGGGCGGTGGG + Intergenic
1199594582 X:149496422-149496444 ATCCAGGGGTTGTAGGCCACAGG + Exonic
1199672483 X:150158815-150158837 TGCCAAGGGTGGGAGGCCAAGGG - Intergenic
1200057278 X:153468280-153468302 AGCAAGGGTAGGCAGGCCGCAGG + Intronic
1200145231 X:153922938-153922960 AGCCAGGGGTGGGTGGGGACAGG + Intronic
1200829582 Y:7678088-7678110 AGCCAGGGGTGGGGCACCTCGGG - Intergenic
1202592462 Y:26500853-26500875 AGCAAGGTGGGGGAAGCCGCTGG - Intergenic