ID: 1067069674

View in Genome Browser
Species Human (GRCh38)
Location 10:43122408-43122430
Sequence CCCCACCCACAAGTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067069669_1067069674 -10 Left 1067069669 10:43122395-43122417 CCCAGTGACTTGCCCCCACCCAC 0: 1
1: 1
2: 3
3: 30
4: 273
Right 1067069674 10:43122408-43122430 CCCCACCCACAAGTGGAGCTTGG No data
1067069664_1067069674 29 Left 1067069664 10:43122356-43122378 CCTGTGGTCCTGAGTAGGGCTTT 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1067069674 10:43122408-43122430 CCCCACCCACAAGTGGAGCTTGG No data
1067069667_1067069674 21 Left 1067069667 10:43122364-43122386 CCTGAGTAGGGCTTTGGGCTCAG No data
Right 1067069674 10:43122408-43122430 CCCCACCCACAAGTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067069674 Original CRISPR CCCCACCCACAAGTGGAGCT TGG Intronic
No off target data available for this crispr