ID: 1067071760

View in Genome Browser
Species Human (GRCh38)
Location 10:43137900-43137922
Sequence CTCCCACGCCACCGCGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067071760_1067071767 14 Left 1067071760 10:43137900-43137922 CCGTGCTCGCGGTGGCGTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1067071767 10:43137937-43137959 GAGGACCCTGGAACATGCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 216
1067071760_1067071764 2 Left 1067071760 10:43137900-43137922 CCGTGCTCGCGGTGGCGTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1067071764 10:43137925-43137947 AGAGAGCCCAGGGAGGACCCTGG 0: 1
1: 0
2: 4
3: 57
4: 503
1067071760_1067071761 -9 Left 1067071760 10:43137900-43137922 CCGTGCTCGCGGTGGCGTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1067071761 10:43137914-43137936 GCGTGGGAGACAGAGAGCCCAGG 0: 1
1: 0
2: 6
3: 43
4: 418
1067071760_1067071762 -8 Left 1067071760 10:43137900-43137922 CCGTGCTCGCGGTGGCGTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1067071762 10:43137915-43137937 CGTGGGAGACAGAGAGCCCAGGG 0: 1
1: 0
2: 3
3: 29
4: 322
1067071760_1067071763 -5 Left 1067071760 10:43137900-43137922 CCGTGCTCGCGGTGGCGTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1067071763 10:43137918-43137940 GGGAGACAGAGAGCCCAGGGAGG 0: 1
1: 1
2: 6
3: 90
4: 916
1067071760_1067071769 19 Left 1067071760 10:43137900-43137922 CCGTGCTCGCGGTGGCGTGGGAG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1067071769 10:43137942-43137964 CCCTGGAACATGCAGTGGTATGG 0: 1
1: 0
2: 1
3: 24
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067071760 Original CRISPR CTCCCACGCCACCGCGAGCA CGG (reversed) Intergenic
900363098 1:2299367-2299389 CTCCCAGGGCACCGAGAGCCCGG - Intronic
900774674 1:4573679-4573701 CTCCCTCCCCACCTCCAGCAAGG - Intergenic
905827112 1:41034228-41034250 CCCCCACCCCAACCCGAGCAGGG - Intronic
907708399 1:56852928-56852950 CTCCCACCCCACCCCCAGCACGG - Intergenic
919042554 1:192410147-192410169 TTCCCACGGCACAGCCAGCAAGG - Intergenic
1062996959 10:1874835-1874857 CTCCCTCGCCACCAAGAGCATGG - Intergenic
1067071760 10:43137900-43137922 CTCCCACGCCACCGCGAGCACGG - Intergenic
1076453276 10:130571780-130571802 CTTACACACCACCGTGAGCAGGG + Intergenic
1079710946 11:23680907-23680929 CTCCCACCTCACCGAGGGCAGGG - Intergenic
1084323367 11:68385684-68385706 CTCCCAGGCCACCGAGATGAAGG - Intronic
1084659891 11:70540474-70540496 CTCCCAGGCTCCCGCGGGCAGGG - Intronic
1085743678 11:79097163-79097185 CTCCGACGCCAGCCCCAGCATGG - Intronic
1091618403 12:2067165-2067187 CTCCCACACCAGCTCGAGCTTGG - Intronic
1100179530 12:92070440-92070462 CTCTCACGCCACCTCTGGCAAGG + Intronic
1100196831 12:92255892-92255914 CTCCCACCCCACAGTGATCAAGG + Intergenic
1103377535 12:120468998-120469020 CTCTCCAGCCACGGCGAGCACGG + Intronic
1105529993 13:21210602-21210624 CTCCCACCCCAGAGGGAGCAGGG - Intergenic
1122736754 14:103847756-103847778 CTCCCCCGCCGCCGGGAGCGCGG - Intergenic
1125519069 15:40338286-40338308 CTCCCATGCCACCATCAGCAGGG + Intronic
1127225200 15:56919738-56919760 CTCCCACCGCGGCGCGAGCAAGG - Intronic
1129737458 15:77974151-77974173 CTCCCATTCAACCGCGAGCCTGG - Intergenic
1131050102 15:89342081-89342103 CTCCCACTCCACCTTGTGCATGG + Intergenic
1133136805 16:3717747-3717769 CTCCCCCACCTCCGCGCGCAAGG - Intergenic
1134339842 16:13334908-13334930 CACCCACGCCTCCTGGAGCAGGG + Intergenic
1141993309 16:87622337-87622359 CACCCAAGCCTCCGTGAGCAAGG + Intronic
1142131781 16:88434525-88434547 CTCCCACGCTACAGGGTGCAGGG + Exonic
1142243266 16:88956695-88956717 CTCCCAGGGCTCCGCCAGCAGGG - Intronic
1145710322 17:26965406-26965428 CTCCTACCCCACCGCCACCAAGG + Intergenic
1148145541 17:45362349-45362371 CTCCCACTCCATCACCAGCATGG + Intergenic
1150660122 17:67067952-67067974 CTCCCACGGCTCCGTGTGCAGGG + Intergenic
1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG + Intergenic
1152351120 17:79784559-79784581 CCGCCACGCCACCGCCACCAAGG + Exonic
1153900503 18:9614194-9614216 CTGCCAGGCCACCGCGAGGCCGG + Intronic
1158537618 18:58322595-58322617 CACCCACACCACAGCAAGCAAGG - Intronic
1160178877 18:76617580-76617602 CTCCCACGAGACCGCAGGCATGG - Intergenic
1164686326 19:30168913-30168935 CTCCCACTCCACCCCTAGCTGGG + Intergenic
1166759511 19:45215864-45215886 CTCCGCCGCCACCGCCACCAGGG - Intronic
1167441833 19:49513313-49513335 CTCCCGGGACACCGCGGGCACGG - Intronic
1167589866 19:50398691-50398713 CTCCCACCCCACTGCCTGCAGGG + Intronic
925470606 2:4157240-4157262 CTCCCAGGCCACAGCGGACATGG + Intergenic
926630896 2:15135454-15135476 CTCCCACTGCACCCCAAGCACGG - Intergenic
932947572 2:76254504-76254526 CTCCTACGCTACCCTGAGCAGGG - Intergenic
936065961 2:109332402-109332424 CTCCCCCAGCACCCCGAGCAGGG + Intronic
948299063 2:236888415-236888437 CTCCCACTCCACGGCACGCAAGG - Intergenic
1175178490 20:57128283-57128305 AGCCCACGCCACCGAGACCATGG + Intergenic
1184251691 22:43264235-43264257 CTCCCAGGCCACAGCCAGGAAGG - Intronic
955350405 3:58189275-58189297 CACCCACCCCACCCCCAGCAGGG + Intergenic
962318555 3:134373657-134373679 CTCCCGCCCCACCACGAGCCCGG + Intronic
963939634 3:151086107-151086129 GCCCCACGCCACCGTGAGCACGG + Intronic
968628886 4:1640168-1640190 CTCCCAGGCCACGGGAAGCAGGG + Exonic
1002926643 6:1609254-1609276 CTTCTTCCCCACCGCGAGCAGGG + Intergenic
1008899561 6:56595780-56595802 CCCCCACCCCACCCCGAGAAGGG + Intronic
1013520039 6:110924391-110924413 CTCCCAGGCATCCCCGAGCAGGG - Intergenic
1015842345 6:137488915-137488937 CTCCGGGGCCACCGCGAGCGCGG + Intergenic
1017723285 6:157259107-157259129 CTCCGAGGCCACCCTGAGCAAGG - Intergenic
1022943700 7:35261902-35261924 CTCCCAAGCCAACGCTATCAGGG + Intergenic
1023988419 7:45111975-45111997 CTCCTACGCCTACGCAAGCAGGG - Intronic
1024250391 7:47501749-47501771 CTCCCACGAGACAGTGAGCAGGG - Intronic
1024505701 7:50159377-50159399 CTCCCAAGCCGCCGGCAGCAGGG + Exonic
1035261141 7:157662426-157662448 CTCCCACGCCACCCAGAGCTGGG + Intronic
1036642181 8:10591574-10591596 CTCCCAGGCCAGCGGGAGCGAGG + Intergenic
1039440874 8:37594645-37594667 CTCCCATGCCTCCTCGTGCAGGG + Intergenic
1041044206 8:53876727-53876749 CTCTGAAGCCACCGCGAGCCTGG - Intronic
1044780187 8:95735596-95735618 CTCCCACACCACCTATAGCATGG + Intergenic
1045917294 8:107487190-107487212 CTCCCACTCCATGGCCAGCATGG + Intronic
1046080291 8:109362709-109362731 CTCCCAGGACCCCGGGAGCAGGG - Intronic
1049216116 8:141409180-141409202 CTCCCAGGCCTCCCCTAGCAGGG - Intronic
1061148968 9:128818364-128818386 CTCCCACCCCACGACCAGCAGGG + Intergenic
1062048562 9:134435560-134435582 CTCCCACGGCACCTTGTGCAGGG - Intronic
1185608704 X:1381480-1381502 CTCCCAGCCCACCGTGATCACGG + Intronic
1187166198 X:16806352-16806374 CTCCCAGGGCAGAGCGAGCATGG + Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic