ID: 1067077476

View in Genome Browser
Species Human (GRCh38)
Location 10:43196434-43196456
Sequence ATGGGAGTCTGTAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067077476_1067077481 2 Left 1067077476 10:43196434-43196456 CCCTCTTCCTTACAGACTCCCAT 0: 1
1: 0
2: 1
3: 27
4: 305
Right 1067077481 10:43196459-43196481 TCCTGACGCCCTCCTACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 137
1067077476_1067077483 3 Left 1067077476 10:43196434-43196456 CCCTCTTCCTTACAGACTCCCAT 0: 1
1: 0
2: 1
3: 27
4: 305
Right 1067077483 10:43196460-43196482 CCTGACGCCCTCCTACCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1067077476_1067077488 29 Left 1067077476 10:43196434-43196456 CCCTCTTCCTTACAGACTCCCAT 0: 1
1: 0
2: 1
3: 27
4: 305
Right 1067077488 10:43196486-43196508 TCCAGCTGTCTTTTTCCATGTGG 0: 1
1: 0
2: 2
3: 29
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067077476 Original CRISPR ATGGGAGTCTGTAAGGAAGA GGG (reversed) Intronic
901248561 1:7754074-7754096 ATTGGAGAATGTAAGGAAAAGGG - Intronic
901916655 1:12505486-12505508 ATGGGCGTCTGTAATTAAAATGG + Intronic
902769224 1:18636122-18636144 ATGGATATCTGTAAGGAAGCAGG + Intronic
902776877 1:18680482-18680504 ATGGGAGACAGAAAGGAGGAGGG - Intronic
902878588 1:19355910-19355932 ATGGGAGCATCTAAGGTAGAAGG + Intronic
905658074 1:39698965-39698987 ATGGGAGTTTGGAAAGAAGAAGG - Intronic
906959955 1:50414208-50414230 TTGGGAGTAAGTAAGGAAGAGGG - Intergenic
907161556 1:52374026-52374048 CTGGGAGTTTGTCAGGAACAGGG + Intronic
907549578 1:55292852-55292874 ATGGCAGGCTTTGAGGAAGAAGG + Intergenic
908359892 1:63358493-63358515 TTGGGAGGCTGTGAGGCAGAAGG - Intergenic
908860345 1:68479178-68479200 ACTGCAGTCTGTAAGTAAGAGGG + Exonic
909951831 1:81728980-81729002 ATGGGAGTAGTTAAAGAAGAGGG + Intronic
910259263 1:85279945-85279967 ATGGCTGTGTGTAAGGAACATGG - Intergenic
910858516 1:91720056-91720078 AGGAGAGTCTGGAATGAAGAGGG - Exonic
912373067 1:109188454-109188476 AAGGGAGGCAGTAAGGAATAAGG + Intronic
912711363 1:111952358-111952380 ATGGGAGAGTGTGAGGCAGAAGG - Intronic
914041753 1:144056549-144056571 ATTGGAGTCTGTAGGTGAGAGGG - Intergenic
914136338 1:144903937-144903959 ATTGGAGTCTGTAGGTGAGAGGG + Intronic
914701814 1:150141109-150141131 ATGGGAGTGGGTAAGGCAGAAGG - Intronic
915280000 1:154815921-154815943 ATGGGTGTCTGTAATGCAGGAGG - Intronic
915493855 1:156267239-156267261 ATGGGAGGCAGTAAGGAGAAGGG + Intronic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915920924 1:159974563-159974585 CTGGGAGCCTTTAAGGAAGAAGG - Intergenic
916909692 1:169333318-169333340 GTGGGAGGCTGTAGGGAAGGTGG + Intronic
916996289 1:170305287-170305309 ATGGGAGTGTAAGAGGAAGAAGG - Intergenic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917626948 1:176855904-176855926 GAGGGAGACTGGAAGGAAGAAGG + Intergenic
917647828 1:177046532-177046554 ATGGTGTTCTGTAATGAAGAGGG - Intronic
917995050 1:180428693-180428715 ATGGGAGCCCTTAAGGAAAATGG + Intronic
918437486 1:184531260-184531282 ATGGGAGTCTCTAAGAAGAAAGG - Intronic
919161747 1:193839469-193839491 AGGGGAGTAGATAAGGAAGAAGG - Intergenic
919403049 1:197144504-197144526 AGAGGAATTTGTAAGGAAGAAGG - Intronic
919906347 1:202081117-202081139 ATGAGGGTCTTTAAGGGAGAAGG - Intergenic
920401478 1:205679354-205679376 AAGAGTGTCTGTCAGGAAGATGG + Intronic
920488621 1:206394804-206394826 ATTGGAGTCTGTAGGTGAGAGGG - Intronic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
920983615 1:210862902-210862924 CAGGGAATCTGTAGGGAAGAAGG - Intronic
921163499 1:212489345-212489367 GTGGGAGTCTGGAAGAATGAGGG - Intergenic
922600261 1:226845933-226845955 ATTGGAATTTGGAAGGAAGAGGG + Intergenic
922860256 1:228810398-228810420 ATGGGGGCAGGTAAGGAAGAGGG + Intergenic
1063418721 10:5893565-5893587 ATGGGATTCAGTAAGGCGGAAGG - Intronic
1064652649 10:17524901-17524923 GTGGGATTGTGTAAGGGAGATGG + Intergenic
1065455411 10:25901840-25901862 AAGGGAGTGGGTAAGGAAGGGGG - Intergenic
1066284125 10:33947623-33947645 GTGGGAGTCACTAAGGAAGATGG - Intergenic
1067077476 10:43196434-43196456 ATGGGAGTCTGTAAGGAAGAGGG - Intronic
1067201557 10:44176520-44176542 ATGGGAGGCTGTAAGGGGGCAGG - Intergenic
1067757268 10:49014726-49014748 AGGGGTGTCTCAAAGGAAGAAGG - Exonic
1067949608 10:50719188-50719210 AGAGGAGTCTTTAAGGAGGAAGG + Intergenic
1068610337 10:59053053-59053075 ATGGGAATCTGGACTGAAGATGG - Intergenic
1068959115 10:62848888-62848910 AAGAGAGTCTGGAAGGAGGATGG + Intronic
1069088978 10:64176431-64176453 ATTTGAGTCAGTAAGGGAGATGG - Intergenic
1070884915 10:79884212-79884234 AGAGGAGTCTTTAAGGAGGAAGG + Intergenic
1071490935 10:86135847-86135869 ATGGGAGTGAGTGAGGAAGACGG - Intronic
1072569682 10:96647827-96647849 CTGGGAGTCTGTGAAGAAGGAGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1074094532 10:110298651-110298673 ATGGCAGTCTGGAGTGAAGATGG - Exonic
1074433676 10:113415449-113415471 ACGGGAGTCTGAGAGGAGGAAGG - Intergenic
1075015198 10:118905598-118905620 ATGGAAGGCTGCAAGGAGGAAGG + Intergenic
1075544293 10:123342866-123342888 ATGGGAGGCTGGAAAGAAGGAGG + Intergenic
1077387825 11:2280513-2280535 AAGGAAGTCTTTCAGGAAGAAGG + Intergenic
1078025405 11:7690276-7690298 ATGAGAATGTGTAAGGAAGCTGG + Intronic
1078712135 11:13803652-13803674 ATGGTTGTCTATAAGGAAGCAGG + Intergenic
1079661884 11:23048327-23048349 TTGGGTGTGTGTAAGGATGAGGG - Intergenic
1081970997 11:47198640-47198662 ATTGGAGGCTGTCAGGAAGTGGG - Intergenic
1083164561 11:60875499-60875521 ATTGGAGTCTGTCAGAGAGACGG - Exonic
1084968910 11:72758836-72758858 ATGTGAGGCTGTAAGGAGCAGGG - Intronic
1085736066 11:79040349-79040371 AAGGCAGTCAGTGAGGAAGAAGG - Intronic
1086971476 11:93085736-93085758 TTGGGTGTTGGTAAGGAAGAAGG - Intergenic
1086992523 11:93319678-93319700 CTGGGAGTTGGTATGGAAGAGGG + Intergenic
1087562551 11:99809056-99809078 ATGTGTGTCTGTAAACAAGATGG - Intronic
1087943993 11:104135999-104136021 ATTGGAGTCTGGAAGGAGAAAGG + Intronic
1090729379 11:129556956-129556978 ATTGGATTTTATAAGGAAGAAGG + Intergenic
1092162406 12:6323120-6323142 TTGGGATTCTGAAAGGGAGAAGG - Intronic
1093380482 12:18485475-18485497 TTGGTAGGCGGTAAGGAAGAGGG - Intronic
1093774178 12:23053202-23053224 ATGAGAGACTGTAAAGAAAAAGG - Intergenic
1093842071 12:23916165-23916187 ATGATAGTGTGTAAGAAAGAGGG - Intronic
1094463648 12:30726797-30726819 ATGGGACTCTTTTAGGAGGAAGG + Intronic
1095434993 12:42177408-42177430 ATGGCCGTCTGTAAGCCAGAAGG - Intronic
1095701848 12:45198689-45198711 ATGGCTGTCTCAAAGGAAGAAGG + Intergenic
1097156270 12:57014502-57014524 TTGAGAGTCTGTGAGGATGAGGG - Intronic
1097858741 12:64495893-64495915 ATGTGATTCTGTCAGGAAAAAGG + Intronic
1098271314 12:68772940-68772962 AAGGGGGTGGGTAAGGAAGATGG + Exonic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1099939051 12:89163249-89163271 ATGTGAATCTGTGAGGAAAATGG - Intergenic
1100443360 12:94638534-94638556 ACGGGAGACAGGAAGGAAGATGG - Intronic
1101075590 12:101126662-101126684 AGAGGAGTCTGGAAGGAAGGTGG - Intronic
1101246978 12:102892775-102892797 GAAGGAGTCTGTAAAGAAGAAGG + Intronic
1102126180 12:110482992-110483014 AAGGGAGTGTGCAGGGAAGAGGG + Intronic
1102189801 12:110978798-110978820 ATGAGAATCTCTAAGGATGAAGG - Intergenic
1104304589 12:127598013-127598035 ATGAGAGTCTGTAAGGAGACTGG + Intergenic
1105769858 13:23598907-23598929 ATGGCAGTCTGTAGGGGAAAAGG - Intronic
1106457288 13:29938382-29938404 AAGGGGGCCTGTGAGGAAGAGGG - Intergenic
1106690631 13:32111574-32111596 TTGAGAATCTGTCAGGAAGAAGG + Intronic
1110419781 13:75293254-75293276 CAGGGAGTCTTTAATGAAGAGGG + Intronic
1111285090 13:86080282-86080304 ATGGGAGAAGGTAAGGTAGAGGG - Intergenic
1111376989 13:87393192-87393214 AATGGAATCTTTAAGGAAGATGG + Intergenic
1111405793 13:87803343-87803365 ATGGGAGTCTTTAATGAATAAGG - Intergenic
1111989620 13:95103720-95103742 ATGGGAGACTGTCAGAAAGATGG - Intronic
1112157600 13:96834545-96834567 AAGGGAATATGTATGGAAGAAGG + Exonic
1113005455 13:105696680-105696702 ATGGTAGTCTGCATGGATGACGG + Intergenic
1113809820 13:113131930-113131952 GTGGGAGTCTGTGAGAAACATGG - Intronic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1115744082 14:36418259-36418281 ACAGGAGGCTGTAAGGAAGCAGG + Intergenic
1115762084 14:36584662-36584684 ATGAGATTGTGTAAGGTAGAAGG + Intergenic
1116263808 14:42662628-42662650 TTGGGAGACTTTAAGGTAGATGG + Intergenic
1116300596 14:43176558-43176580 ATGGGAGTGTGTCATGAAAAAGG - Intergenic
1117166706 14:53041769-53041791 ATGAGAGTCTGGAAGAAAGAAGG + Intronic
1117677521 14:58170072-58170094 ATGGGAGAGTGAATGGAAGAAGG + Intronic
1117748227 14:58893062-58893084 ATGAGAGTCTTCAAGGCAGAAGG + Intergenic
1118999623 14:70870545-70870567 GTGTGATTCTGTCAGGAAGAGGG - Intergenic
1119371210 14:74145412-74145434 CTGGCATACTGTAAGGAAGAAGG - Intronic
1121310718 14:92933704-92933726 CTGGCAGTCTGAGAGGAAGAAGG + Intronic
1122749069 14:103919559-103919581 ATGAGGGTCTATAAGGAAAAGGG + Intronic
1125815259 15:42578453-42578475 ATGGGAAACTGTGAGGTAGAGGG - Intronic
1126114850 15:45199181-45199203 ATGAGAGGCTGGAAGGAAGTGGG - Intronic
1126379721 15:48033831-48033853 ATGGGAGGGAGAAAGGAAGATGG + Intergenic
1126906162 15:53368283-53368305 ATGCGACTATTTAAGGAAGAAGG + Intergenic
1127160691 15:56181732-56181754 ATGGGATTATCTAAGGAGGATGG + Intronic
1128106953 15:65052085-65052107 ATGGGAGTTATTAAGGAAGTGGG + Intronic
1128491859 15:68155010-68155032 ATGTGAGCCTGTATGGAAGAGGG + Intronic
1130942151 15:88519874-88519896 ATGGGAGTCTGGAAGGACTATGG - Intronic
1133389220 16:5395740-5395762 ATGCGAGTCTGCTGGGAAGATGG - Intergenic
1133478965 16:6151003-6151025 TTCTGAATCTGTAAGGAAGAAGG - Intronic
1133677836 16:8092234-8092256 AAAGGAGTCAGGAAGGAAGATGG + Intergenic
1133713456 16:8424678-8424700 ATTGAACTCTGGAAGGAAGAGGG + Intergenic
1139801528 16:69526870-69526892 TTGGGAGTTTGTAAGGAATTAGG - Intergenic
1140161768 16:72503520-72503542 ATGGGAGTCTTTAAAAATGAAGG + Intergenic
1140388708 16:74565897-74565919 ATGGGATCCTGTAACAAAGACGG - Intronic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141594241 16:85087758-85087780 ATGGGATTCTCTAAAGAATATGG - Intronic
1143029555 17:3960206-3960228 AACGGAGTGTGTCAGGAAGAGGG - Intronic
1143537476 17:7549776-7549798 ATGTGAGTCTGCGTGGAAGAGGG + Intronic
1145062322 17:19741042-19741064 ATGAGAGGCTGTAAGGCACAAGG - Intronic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1147198726 17:38785139-38785161 CTGGGAGTCTGTATTGATGAGGG - Intronic
1148679573 17:49465978-49466000 ATGTGAGACTGAAAGGGAGAAGG - Intronic
1149490032 17:57077982-57078004 ATGGGTGGCTGTCAGGAATATGG - Intergenic
1150472130 17:65446380-65446402 GTGGGAGTCTGTCAGGTAGCAGG + Intergenic
1152154408 17:78623288-78623310 ATGGGACCCTGGGAGGAAGAAGG - Intergenic
1153926439 18:9839139-9839161 ATAGGAGTATGACAGGAAGAGGG + Intronic
1155192933 18:23447416-23447438 ATGGCAGGCTGTAAGGACAAGGG - Intergenic
1155891392 18:31274953-31274975 TTGGGAGTTTGTAAGCAAGCAGG - Intergenic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156198474 18:34803157-34803179 ATGTGACTCTGTCATGAAGAAGG - Intronic
1156205555 18:34882289-34882311 AAGGGAGGGTGGAAGGAAGAAGG - Intronic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1156637803 18:39051933-39051955 ATGGGAGCCTTCATGGAAGAGGG - Intergenic
1157557520 18:48622369-48622391 ATGGGAGTGTGTGGGGGAGAGGG + Intronic
1157989445 18:52477403-52477425 TTGGCATTCTGTCAGGAAGATGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158328574 18:56336881-56336903 ATGGGAGTCTTTTGAGAAGAAGG - Intergenic
1160178815 18:76617278-76617300 ATGGGACTCTGGAAGGGAGAGGG - Intergenic
1161634701 19:5380448-5380470 ATTGGGGTCTGTAAGGGAGAGGG - Intergenic
1168571784 19:57476665-57476687 ATGGGAACCTGTGGGGAAGAGGG + Exonic
925628995 2:5869585-5869607 GTGGGCGTCAGTGAGGAAGAAGG - Intergenic
926153304 2:10436288-10436310 AGGCGAGTCTGTAAGTTAGAAGG - Intergenic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
927474924 2:23405886-23405908 ATGGGTAGGTGTAAGGAAGAGGG + Intronic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
929554371 2:42916161-42916183 ATGGGATTGTTGAAGGAAGAAGG + Intergenic
930327004 2:49932631-49932653 ATGGAAGAATGTAAGAAAGAAGG - Intronic
931300137 2:60971797-60971819 ATAGAAATCTGTAAGGAGGAGGG - Intronic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
932566513 2:72914588-72914610 ATGAGAGTCTGGGAGGAACAGGG + Intergenic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
933680562 2:85096038-85096060 ATGGCAGTGTGTAAGGAAGCTGG - Intergenic
935268740 2:101415829-101415851 AAGGGAGGCTGTCTGGAAGAAGG + Intronic
935649594 2:105370872-105370894 ATGGGATTCTGTAAAGCAGCAGG + Intronic
935965519 2:108469647-108469669 ATAGGATTCTGTAACAAAGATGG + Exonic
936124052 2:109771657-109771679 TTTGGAGTCTGAAAGGAAGTAGG + Intergenic
936220637 2:110599807-110599829 TTTGGAGTCTGAAAGGAAGTAGG - Intergenic
936646615 2:114379144-114379166 ATGGGATTCTGTAAGTTGGATGG - Intergenic
936745971 2:115577029-115577051 ATGGGAGTATTGAAGGAACAAGG + Intronic
938513425 2:131976602-131976624 ATGGAAGTCCCAAAGGAAGAGGG + Intergenic
939190038 2:138906248-138906270 ATAGCAGTCTCTAATGAAGAAGG + Intergenic
940223813 2:151381596-151381618 ATGAGGGTCTGCAAGGGAGAAGG - Intergenic
943181232 2:184544286-184544308 ATGTGAGTCTGTGAATAAGAGGG + Intergenic
945218473 2:207460457-207460479 ATGAGGGTCTTCAAGGAAGAAGG - Intergenic
945511322 2:210706564-210706586 ATGGGAGTCTCTAATAGAGATGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946550894 2:220801019-220801041 ATGGGATTCTCTAAGAAAGGAGG - Intergenic
947834030 2:233162695-233162717 AGAGGAGTCTGGGAGGAAGAGGG + Intronic
948130970 2:235600399-235600421 ATGGGGGTCTATAGGGCAGAGGG - Intronic
948554326 2:238796793-238796815 ATGTGAGAATGTCAGGAAGAAGG - Intergenic
949067623 2:242003046-242003068 ATGGGAGACAGTCAGCAAGAGGG + Intergenic
1169300817 20:4440653-4440675 ATGGGAGCATCAAAGGAAGAGGG + Intergenic
1169773604 20:9228311-9228333 ATGAGAGAGAGTAAGGAAGAAGG + Intronic
1170795054 20:19539954-19539976 ATGAGAGTCTTCAAGGGAGATGG + Intronic
1171052322 20:21871488-21871510 ATTGGAGTCTCTCAGGAAGGAGG - Intergenic
1172344803 20:34189768-34189790 AAGGAGGTCTGTAAGGCAGAGGG - Intergenic
1173054066 20:39594470-39594492 ATGAGAATCTCTAAGCAAGATGG + Intergenic
1174112597 20:48206471-48206493 AGGGGCGTGTGTGAGGAAGAGGG - Intergenic
1174203428 20:48823128-48823150 ATGGGAGTCTCTGAGGAACAGGG - Intronic
1174330212 20:49812062-49812084 GTGGAAGTCCGTAAGGAACAGGG + Intergenic
1174858465 20:54068550-54068572 ATGGGACTCTGCAAGGGAAAAGG - Intronic
1174886449 20:54340303-54340325 AAGGGAGTATGGAAGAAAGAAGG - Intergenic
1175282439 20:57813166-57813188 AGGGGAGTCTGTGGGGCAGAGGG + Intergenic
1175658350 20:60791560-60791582 ATGGGAGAATGTATGGAAGGAGG - Intergenic
1175752743 20:61510375-61510397 ATGGGAGTTTGTGTGGAAGCTGG + Intronic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1176964831 21:15200609-15200631 ATAAGAGTCTGTAAGAATGAAGG - Intergenic
1177825024 21:26073285-26073307 AAGGGAGCCTGAAAGGAAAATGG + Intronic
1178889960 21:36513040-36513062 ATGGGATTCTGTAAACAAGGAGG - Intronic
1179262079 21:39766165-39766187 ATGGGAGGAAGTGAGGAAGAAGG - Intronic
1179279866 21:39925147-39925169 AGGGGGCACTGTAAGGAAGATGG - Intronic
1180192660 21:46173501-46173523 ATGGAAGTCTGTAGGGAAAGGGG - Intronic
1180589705 22:16926664-16926686 TTGGGAGTCCGGAAGGGAGAAGG - Intergenic
1183469641 22:37998580-37998602 GAGGGAGTCTGGAAGGAACAGGG - Intronic
1183662651 22:39230572-39230594 ATGGTTGTCTGGAAGGAAGTGGG + Intronic
1184011795 22:41754299-41754321 AGAGGAGACTGTCAGGAAGAAGG - Intronic
1184610633 22:45601146-45601168 ATGAGAGTCTTTCAAGAAGAGGG + Intergenic
949469638 3:4380984-4381006 GAATGAGTCTGTAAGGAAGAGGG + Intronic
950555491 3:13693341-13693363 ACTGGTGTCTGTTAGGAAGAAGG - Intergenic
951578077 3:24133964-24133986 ACTGGAGTCTGTAGGGCAGAGGG - Intronic
954892043 3:53939618-53939640 CTGGGGGTCTGTCATGAAGATGG - Intergenic
956296868 3:67724419-67724441 AGGAGAGTCTGAAAGGTAGAGGG - Intergenic
957219494 3:77363738-77363760 ATGAGGGTCTTCAAGGAAGAAGG + Intronic
958188891 3:90158814-90158836 ATGGGAGTCAATCAGGAAAAGGG - Intergenic
958646261 3:96878716-96878738 ATAGTAATTTGTAAGGAAGACGG - Intronic
958717286 3:97800822-97800844 ATGGCAGTCTGCAACCAAGACGG - Intronic
959411199 3:106024540-106024562 ATTGGAGTTAGTAAAGAAGAGGG - Intergenic
959930887 3:111980916-111980938 ATGGGAGTCAGTAATAAAAAGGG + Intronic
961072609 3:123948778-123948800 CTGAGATTCTGTAAGTAAGAGGG + Exonic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
962631405 3:137279921-137279943 AACAGAGTCTGTAAGGATGAAGG + Intergenic
962642873 3:137406672-137406694 ATGGGAGGGTGTCAGGGAGAGGG + Intergenic
962674368 3:137743539-137743561 CTGGGATTCTGTTAAGAAGAAGG + Intergenic
964140097 3:153388129-153388151 CTGTGATTCTGTAAGCAAGAAGG + Intergenic
967072586 3:185974461-185974483 GTGGGAGGCTGTAGGGAAGCAGG + Intergenic
967236005 3:187384260-187384282 GTGGGATGCTGGAAGGAAGAAGG - Intergenic
967386750 3:188919538-188919560 ATGACAGTCTTTAAGGGAGAAGG + Intergenic
968745102 4:2355974-2355996 ATGGGAGTCTGTGGGGAACACGG - Intronic
969635005 4:8363740-8363762 ATGGGTGGCAGTAAGGAAGTCGG + Intergenic
971353813 4:25876496-25876518 TGGGGTGTCTGTCAGGAAGAGGG - Intronic
971499872 4:27307191-27307213 TTGGGAATCTGTACTGAAGAAGG - Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
972011448 4:34188393-34188415 CTCGGGGTCTGTAAAGAAGAAGG + Intergenic
972066055 4:34945605-34945627 AGGAGAGTGTGTTAGGAAGAGGG - Intergenic
972090750 4:35279473-35279495 CTGGCAGTCTCTAAGGAATATGG - Intergenic
973793415 4:54399130-54399152 ACTGGAGTTAGTAAGGAAGAAGG + Intergenic
974164921 4:58189818-58189840 ATGGGATTATGTTAGGACGAAGG + Intergenic
974902864 4:68022447-68022469 ATGGGAGTCAGTGAGCAAGTGGG - Intergenic
976266527 4:83190577-83190599 ATGAGGGTCTCCAAGGAAGAAGG + Intergenic
981535064 4:145791216-145791238 ATGGCTGTCTGTGAGGAAGCAGG - Intronic
983111691 4:163758195-163758217 GAGGGAGTCTGGAAGGCAGAAGG + Intronic
984568910 4:181366164-181366186 ATGAATGTCTGTCAGGAAGACGG - Intergenic
985993775 5:3584916-3584938 ATGGGAGGAAGGAAGGAAGAAGG + Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
987984182 5:25124593-25124615 AAGGGAGTTTGTAATGAGGATGG - Intergenic
990196133 5:53318528-53318550 ATGAGAGTTTTTAGGGAAGAAGG + Intergenic
991177688 5:63708963-63708985 CTGGGAATCTGTAAGAAAGGAGG - Intergenic
993419682 5:87685290-87685312 ATGGTTGTCTATGAGGAAGAGGG - Intergenic
995149592 5:108826853-108826875 CTGGGAGTCTGCAAAGAACAAGG - Intronic
995226651 5:109708369-109708391 ATGGGAGTTTGTAAGGAAGGGGG + Intronic
995600999 5:113795981-113796003 ATGGCTGTATGAAAGGAAGAGGG + Intergenic
998025493 5:138812121-138812143 ATGTAGGTCTGTAAAGAAGATGG - Intronic
998389572 5:141778820-141778842 AGGGGAGTCTGTAGGGAAGCTGG - Intergenic
998389808 5:141780224-141780246 AGGGGAGTCTGTAGGGAAGCTGG - Intergenic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1004124757 6:12862416-12862438 CTGGGAGACTGTGAGGAAGGAGG + Intronic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004601754 6:17157124-17157146 AAGGGAGTGTGTGAGGAGGAGGG - Intergenic
1005447746 6:25942033-25942055 AAGGGAATGTGCAAGGAAGAGGG + Intergenic
1005632906 6:27725463-27725485 ATAGTAGTCTGGGAGGAAGAGGG - Intergenic
1006527402 6:34618739-34618761 AGGGAAGACTGTAAGGAAAAGGG - Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1009548999 6:65062102-65062124 TTGGGAGTCTGTCATGTAGAGGG - Intronic
1010052856 6:71527924-71527946 CTGGGAGTCTTTAAGAAAGAAGG - Intergenic
1011507014 6:88056428-88056450 ATGGAAGGATGGAAGGAAGAAGG - Intronic
1012396693 6:98806359-98806381 ATGGAAGTCTTTCAGGCAGAAGG - Intergenic
1013131418 6:107237040-107237062 TTGGGAGGCTGTAAGGCAGAAGG - Intronic
1013180473 6:107713162-107713184 ATGGGCATGTGTAAGGCAGAGGG - Intronic
1014294689 6:119603974-119603996 TTGGGAGGAGGTAAGGAAGAGGG + Intergenic
1014813457 6:125909895-125909917 ATGGGATGCTGTCAGGAAGTAGG + Intronic
1015156891 6:130106722-130106744 ATGTGAGTCAGGATGGAAGATGG - Intronic
1015721573 6:136248121-136248143 ATATGAGATTGTAAGGAAGACGG - Intronic
1016554969 6:145326288-145326310 CCAGGAGTCAGTAAGGAAGATGG - Intergenic
1018241192 6:161776548-161776570 TGGGCAGTCTGTAAGCAAGAAGG - Intronic
1019152456 6:170018008-170018030 ATGGGACTTTTTAAGGAAAATGG - Intergenic
1020073623 7:5243360-5243382 CTGCGAGTCTGTCAAGAAGAGGG - Intergenic
1020581117 7:10003722-10003744 ATGTTAGTCTGTCAGGAAGATGG + Intergenic
1022135379 7:27442700-27442722 ATGAGAGTCTTCAAGGAAGAAGG - Intergenic
1022673345 7:32476417-32476439 ACAGGAGCCTGCAAGGAAGAGGG - Intergenic
1024157415 7:46639256-46639278 ATGGGAGGGTGTGGGGAAGAGGG - Intergenic
1024894794 7:54245641-54245663 ACAGGAGTTTGAAAGGAAGAGGG - Intergenic
1025056841 7:55772040-55772062 ACGGGAGGATGTAAGGAGGAAGG + Intergenic
1027267584 7:76502794-76502816 CAGGGATGCTGTAAGGAAGAAGG - Intronic
1027319395 7:77002659-77002681 CAGGGATGCTGTAAGGAAGAAGG - Intergenic
1029859916 7:103559539-103559561 ATGCAAGTGTATAAGGAAGAGGG - Intronic
1030115374 7:106058762-106058784 ATGGAAGTCAGTATGGAGGATGG - Intergenic
1030374199 7:108736681-108736703 TTGGGAGTGTGTGAGGAAAATGG - Intergenic
1030723376 7:112896471-112896493 ATGGGATCCTGTAAGCATGAAGG - Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033588062 7:142788848-142788870 AAGGGATTCTGTTAGGAAAAAGG - Intergenic
1033902845 7:146163765-146163787 AAGTGTGTTTGTAAGGAAGAGGG + Intronic
1037231470 8:16663962-16663984 CTGGAAGTCTGTAAGGCAGATGG + Intergenic
1039505739 8:38051112-38051134 TTGGAAGTCTGTATGGAAAATGG - Intronic
1041980067 8:63847280-63847302 ATAGGAGTGTGTAATGAAGATGG + Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1043311781 8:78869689-78869711 AAGGAAGACAGTAAGGAAGAAGG - Intergenic
1045179406 8:99763880-99763902 ATGAGATGCTGTAAGGACGAGGG - Intronic
1045824769 8:106384205-106384227 ATTGGAGTCTGTGATGATGATGG + Intronic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1048145806 8:131842102-131842124 ATAGTAGTATGTAAGGAGGAAGG - Intergenic
1048389243 8:133945826-133945848 AAGCCAGTCTGTAAGGAAAATGG + Intergenic
1050663425 9:7908739-7908761 ATTAGAGTCTGTAAGCAAAAGGG + Intergenic
1050984564 9:12065897-12065919 ATGGGAGACTTTAATGAAGAAGG - Intergenic
1051716181 9:19987136-19987158 ATTGGAATGTGGAAGGAAGATGG + Intergenic
1052340849 9:27362857-27362879 CTGGACGTCTGTAAGGCAGAAGG - Intronic
1052957489 9:34264691-34264713 ATTTGAGTCTGTGAGGAACAGGG - Intronic
1055636341 9:78282700-78282722 CAGGGAGTCTGAAAAGAAGAAGG - Intergenic
1057958069 9:99427552-99427574 ATGTGATTATGTTAGGAAGATGG + Intergenic
1058061254 9:100498821-100498843 GGAGGAGTCTGTAAAGAAGATGG + Exonic
1186310560 X:8313316-8313338 AGGGGAGTCTGGATGGAAAATGG + Intergenic
1186686320 X:11928618-11928640 TTGTGAGTCTGTAAAGAAAAAGG + Intergenic
1187242562 X:17527154-17527176 ACTGGAGTCTGTAATAAAGAGGG + Intronic
1189756643 X:44278632-44278654 ATGCGAGTCTATAGGGAAGGAGG - Intronic
1190324764 X:49199817-49199839 AGGGGAGAGTGGAAGGAAGATGG - Intronic
1190381847 X:49846866-49846888 ATGGAAGCCTGTTAGGGAGATGG + Intergenic
1190594820 X:52042020-52042042 ATGGGAGTGTGGCAGGAAGTGGG + Intergenic
1190614004 X:52212053-52212075 ATGGGAGTGTGGCAGGAAGTGGG - Intergenic
1192031199 X:67514300-67514322 ATTGGAGCCTGTCAGGGAGAGGG + Intergenic
1193686667 X:84584885-84584907 ATGGGAGGTAGGAAGGAAGAAGG + Intergenic
1194255205 X:91626598-91626620 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1194518857 X:94893652-94893674 ATTGGTGGCTGGAAGGAAGAAGG - Intergenic
1195457888 X:105090016-105090038 ATGGGAGAGAGTAAGGAAGAGGG + Intronic
1196105314 X:111888952-111888974 ATGGGAGGCTGTAAGGGAGTAGG + Intronic
1196569271 X:117246824-117246846 ATAGAAGTCTATCAGGAAGAGGG - Intergenic
1200573932 Y:4865859-4865881 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1202256968 Y:22931712-22931734 AAGGGAGCCTGTAAAGAAAAAGG - Intergenic
1202409959 Y:24565460-24565482 AAGGGAGCCTGTAAAGAAAAAGG - Intergenic
1202460823 Y:25104612-25104634 AAGGGAGCCTGTAAAGAAAAAGG + Intergenic