ID: 1067077733

View in Genome Browser
Species Human (GRCh38)
Location 10:43197678-43197700
Sequence CTGTGGGATTGGAGGTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 347}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067077733_1067077746 5 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077746 10:43197706-43197728 GACAGGGCTCTCTCCCTGGTAGG No data
1067077733_1067077748 11 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077748 10:43197712-43197734 GCTCTCTCCCTGGTAGGGCCAGG No data
1067077733_1067077747 6 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077747 10:43197707-43197729 ACAGGGCTCTCTCCCTGGTAGGG No data
1067077733_1067077752 23 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077752 10:43197724-43197746 GTAGGGCCAGGCTGGAACCACGG No data
1067077733_1067077745 1 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077745 10:43197702-43197724 GGTGGACAGGGCTCTCTCCCTGG No data
1067077733_1067077749 15 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077749 10:43197716-43197738 TCTCCCTGGTAGGGCCAGGCTGG No data
1067077733_1067077754 29 Left 1067077733 10:43197678-43197700 CCTCCTGACCTCCAATCCCACAG 0: 1
1: 1
2: 3
3: 33
4: 347
Right 1067077754 10:43197730-43197752 CCAGGCTGGAACCACGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067077733 Original CRISPR CTGTGGGATTGGAGGTCAGG AGG (reversed) Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901620970 1:10586977-10586999 CTGTGGTATTAGAAGTTAGGTGG + Intronic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
902177456 1:14661646-14661668 CTTTGGGATTGGGGGACGGGGGG + Intronic
902564785 1:17304357-17304379 CTCTGGGACAGGAGCTCAGGTGG + Intergenic
902873116 1:19326023-19326045 CTGAGGGCAGGGAGGTCAGGAGG - Intronic
902878230 1:19353625-19353647 TTGGGGGATGGGTGGTCAGGGGG - Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
910159633 1:84259331-84259353 GGGTGGGAGTGGAGGTCAGTTGG + Intergenic
910329301 1:86051546-86051568 CTGTGTGATTGGTGGGCAAGAGG + Intronic
912374516 1:109199466-109199488 GGGTGGGATTGGAGTTGAGGTGG - Intronic
912638361 1:111320116-111320138 CTGTGGGAGTGGAAGTGTGGAGG - Intronic
912848557 1:113101026-113101048 CTAGGGGATTGGAGGTTAGTTGG + Intronic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915520440 1:156439369-156439391 CTGTAGCATTGGAGGACAGGGGG + Intergenic
917628783 1:176872862-176872884 CTGTGGGATAGGAGGTGCAGAGG - Intronic
918323527 1:183387863-183387885 CTGTTTGATTGGGAGTCAGGAGG + Intronic
918395929 1:184112930-184112952 GAGTGGAGTTGGAGGTCAGGAGG - Intergenic
918632909 1:186740139-186740161 ATGTGGGTTTGGAGTTCAGGAGG - Intergenic
919542719 1:198871506-198871528 TTGTGGGATGGGAGGTGGGGAGG - Intergenic
919625807 1:199909109-199909131 CAGTGAGGTTGGAGGTCTGGAGG + Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919808150 1:201392970-201392992 CTGTTGGATTGGATGTTGGGTGG + Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921178688 1:212614929-212614951 CTCTGGTGTTGGAGGTCTGGTGG + Intronic
921260895 1:213384367-213384389 CTGTGGTCTGGGAGGTCAAGGGG + Intergenic
922210346 1:223481446-223481468 CTGTGTGTTTGGGAGTCAGGAGG - Intergenic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
923146430 1:231201989-231202011 CGGTGAGATTTGAGGTGAGGAGG + Intronic
923836214 1:237614255-237614277 CAGTGGCATAGGAGCTCAGGTGG - Exonic
923861353 1:237894955-237894977 CTGAAGGCTTGGAGGTTAGGGGG + Intergenic
924415044 1:243849983-243850005 CGGAGGGAGTGGAGGCCAGGCGG + Intronic
1064477337 10:15705374-15705396 CTGCTGGATTGGATGGCAGGAGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067439938 10:46302928-46302950 CTGTGGGGTTAGAGGCCATGAGG + Intronic
1068102220 10:52569703-52569725 TTGTGGGTTTTGAAGTCAGGTGG - Intergenic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1069616833 10:69811557-69811579 CTGTGACATGGGAGGTCAGAGGG + Intronic
1069901322 10:71708177-71708199 CTGGAGGTTTGGGGGTCAGGAGG + Intronic
1070307654 10:75249092-75249114 CTGTGTGATTGGTTGGCAGGAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1073834245 10:107422826-107422848 CTGTTGGAGTGGAGGTTAGTGGG - Intergenic
1074416395 10:113270707-113270729 ATGTGGGATTGGGGGACTGGAGG + Intergenic
1074437650 10:113447636-113447658 GTCTGGGATAGGAGGTGAGGTGG - Intergenic
1075221147 10:120585860-120585882 CGGGGGGATTGGAGGACAGCAGG - Intronic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1075474031 10:122717816-122717838 CTGGGGTAATGGAGGTAAGGCGG - Intergenic
1076440879 10:130480733-130480755 TTGTGGAATGGGAGGCCAGGAGG + Intergenic
1076580251 10:131503304-131503326 CTGGGTGATTGGAGGTGATGTGG + Intergenic
1076708083 10:132313087-132313109 TGGTGGGATGGGAGGTCAGACGG + Intronic
1076762114 10:132611093-132611115 ATGTGGGGTGGGAGGTGAGGTGG + Intronic
1077278932 11:1733267-1733289 TGGTGGGATGGGAGGGCAGGAGG - Exonic
1077365182 11:2158722-2158744 CTGTGGCCTGGGAGGTCAGCGGG - Intronic
1081132275 11:39394745-39394767 CTGTGGGATCGGTGGTGAGGTGG + Intergenic
1081752538 11:45522194-45522216 CTGTGGGACTGAAAGTCAGGTGG - Intergenic
1083184192 11:61008005-61008027 CGGTGGGGGTGGAGGTCTGGAGG - Intronic
1083847670 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG + Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083860745 11:65418689-65418711 CTGTGGGGTCCCAGGTCAGGAGG - Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084669384 11:70596278-70596300 CTGTGGGAATTGAAGTCAGCAGG - Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085346567 11:75771884-75771906 CTGTTGAATTTGAGGGCAGGAGG - Intronic
1085475930 11:76788926-76788948 CTGTGGGGTGAGAGGCCAGGAGG + Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1088785896 11:113181512-113181534 CTGTCGGAGTGGAGGACTGGGGG + Intronic
1090192038 11:124778512-124778534 CTGTAGGGATAGAGGTCAGGAGG + Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090513321 11:127398562-127398584 CTCTGGGATGGGAAGACAGGGGG - Intergenic
1091818127 12:3454777-3454799 CTGTGGGATTCTAGGTCAATAGG - Intronic
1092006491 12:5074553-5074575 AGGTGGGATGGGAGGACAGGTGG + Intergenic
1092840313 12:12534101-12534123 CTGTGGGATTGGAAGAGAAGTGG - Intronic
1093240281 12:16661912-16661934 TTGTGAGATTGGAGGTGAAGAGG + Intergenic
1093450294 12:19306309-19306331 TTGTGGGGTTGGAGGCGAGGTGG + Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1097222828 12:57460853-57460875 CTGTGGGCAAGGAGCTCAGGAGG + Intronic
1097754467 12:63394008-63394030 CTTCGGGATTACAGGTCAGGAGG + Intergenic
1098533109 12:71563319-71563341 CTGGTGCAGTGGAGGTCAGGAGG - Intronic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1100614626 12:96221454-96221476 CGGTGGGTTTGGAGGTCTGCAGG - Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100739878 12:97580390-97580412 CTGTGGGATTGAAGGTTGGGTGG + Intergenic
1100981944 12:100168888-100168910 AGGTGGGATGGGAGGTCTGGGGG - Intergenic
1102418955 12:112788755-112788777 CTTTGGGATTGGAAGCCAAGAGG + Intronic
1102488789 12:113276477-113276499 CTTCTGGATCGGAGGTCAGGAGG + Intronic
1102981461 12:117244895-117244917 GGGTGGGATGGGAGGACAGGAGG + Intronic
1103361780 12:120358899-120358921 CTGGGGGATAGGATGTCAGAAGG + Intronic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103995322 12:124825946-124825968 ATGTGGGATGGGTGGTCTGGAGG + Intronic
1105423535 13:20273536-20273558 CTGTGGGTGTGGAGGTCCTGTGG + Intergenic
1107617423 13:42184616-42184638 CTTTGGGAGTGCAAGTCAGGAGG + Intronic
1109077690 13:57858606-57858628 CTGTGGGATTGGAGGGCAAGAGG + Intergenic
1112135256 13:96571040-96571062 CTGTGAGAATGTAGTTCAGGAGG + Intronic
1112265548 13:97920224-97920246 CGGTGGGAGTGGGGGACAGGGGG - Intergenic
1112338903 13:98536900-98536922 CTGGGCGACTGGAGGACAGGCGG - Intronic
1113897533 13:113775676-113775698 CTGAGGGAGTGGAGCACAGGCGG + Intronic
1114717082 14:24838361-24838383 CTGTGGAATTGGAGGAAATGTGG + Intronic
1116117755 14:40678869-40678891 CTGGTGGATCCGAGGTCAGGAGG + Intergenic
1116223357 14:42115343-42115365 CTGAGGCACTGGAGATCAGGTGG - Intergenic
1118282774 14:64444362-64444384 CAGTGGGGTTGGAAGTCAAGGGG - Intronic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119884773 14:78131048-78131070 CTTTGGAATGGGAGGTCAGGAGG - Intergenic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1120831767 14:89003797-89003819 CTGTGGCCTTGGAGATCAGCAGG - Intergenic
1121209066 14:92193003-92193025 ATGTGGGATGGGAGGGGAGGCGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1121620787 14:95346878-95346900 ATGTGGGGTTGGAGGTGGGGAGG - Intergenic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1122093566 14:99355149-99355171 GTGTGGGAGTGGAGGACATGGGG - Intergenic
1122374531 14:101249142-101249164 ACGTGGGTTTGGAGGTGAGGAGG + Intergenic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122695227 14:103549165-103549187 CTGTGGGAATGGCCATCAGGTGG + Intergenic
1122792510 14:104190245-104190267 CTGTGGGTTTGGGGATCTGGGGG + Intergenic
1122805365 14:104253672-104253694 CTGAGGGAGTGGAGGGCTGGGGG + Intergenic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1123680383 15:22758536-22758558 CTTTTGGATTTGAGGGCAGGGGG + Intergenic
1123682339 15:22771656-22771678 AGGTGGGATGGGAGGTCTGGGGG - Intergenic
1123762313 15:23442414-23442436 AGGTGGGATGGGAGGTCTGGGGG - Intronic
1124332597 15:28832999-28833021 CTTTTGGATTTGAGGGCAGGGGG + Intergenic
1124406913 15:29401098-29401120 CTCTGGGTTTGCAGGTCAGCTGG - Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125482332 15:40089196-40089218 CTGAGGGGGTGGAGGTCGGGGGG + Exonic
1125899124 15:43329247-43329269 TTGTGGGACTGGAGTTCAGTGGG - Exonic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128092966 15:64931418-64931440 CCGTGGGATTGGGGGTCACTTGG + Intronic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1130303913 15:82700124-82700146 CAGTGGGATTGGAGCTGAAGAGG - Intronic
1131589443 15:93732096-93732118 CTGTGTCTTTGGAGGTCAGGGGG + Intergenic
1131599283 15:93830211-93830233 ATGGGGTATTGGAGGACAGGAGG - Intergenic
1131835222 15:96383709-96383731 CTGTGGGATGGAAGGCCATGTGG - Intergenic
1132298742 15:100763604-100763626 GTGTGGGATAGGATGACAGGGGG - Intergenic
1132872468 16:2121987-2122009 CTGTGGGAGCGGAGCTCCGGTGG - Intronic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133344348 16:5060076-5060098 CTGTGGCATGGGAGGCCAGCGGG + Intronic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1135991540 16:27221607-27221629 CTGGGGGATTTGAGGCCAGGGGG + Intronic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1137445508 16:48529531-48529553 CTGTAGGATTGCAGGCCTGGTGG - Intergenic
1137722047 16:50633226-50633248 GAGTGGGATTGGAGGTGCGGGGG - Exonic
1138448204 16:57077848-57077870 CTGCGGGAGAGGAGGCCAGGTGG - Intronic
1138532578 16:57642758-57642780 GTTTGGGCTTGGAGGTTAGGCGG + Intronic
1139493050 16:67297313-67297335 TTGTGGGCTTGGAGGTGAGGAGG + Intronic
1141155380 16:81593370-81593392 CTGGGGGGTTGGAGGGCGGGGGG + Intronic
1141473083 16:84252615-84252637 CTGTGAGATGGGAGGCCTGGAGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142076533 16:88121105-88121127 CGGTGGGATGGGGGGTCGGGAGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1147309283 17:39584919-39584941 CTGAGGTATTGGAAGGCAGGTGG + Intergenic
1147864723 17:43545035-43545057 TAGTGGAATTGGAGGTGAGGTGG + Intronic
1147948769 17:44095509-44095531 CTGTGGGAATGGGGGTGGGGTGG + Intronic
1149156429 17:53635635-53635657 CTATGGGTTGGGAGGTCATGAGG - Intergenic
1149359601 17:55880234-55880256 ATGTGGTATTGGAGTTCAGTTGG + Intergenic
1151341386 17:73473212-73473234 CTCTGGCATTGGGGGGCAGGCGG + Intronic
1151758313 17:76087218-76087240 CCCTGGGACTGGAGCTCAGGGGG - Intronic
1151850869 17:76688814-76688836 CTGTGGGATTGAAGGTCATGGGG + Intronic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1152150784 17:78599670-78599692 CTGTGAGATTGGAGGTGGGGGGG - Intergenic
1153833170 18:8940890-8940912 AAGTGTGATTGGAGGACAGGAGG - Intergenic
1154121368 18:11655118-11655140 GTCTGGGAGTGGAGCTCAGGAGG - Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1156261832 18:35451658-35451680 GTGTGGGATTTGGGGTCAGTGGG + Intronic
1158673694 18:59499936-59499958 CCTAGGGATTGGAGTTCAGGGGG + Intronic
1161607169 19:5221543-5221565 CAGTGGGATTGGGGCTCAGTCGG - Intronic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161820733 19:6529255-6529277 CTGGGGGGTTGGGGATCAGGGGG + Intergenic
1163082276 19:14952748-14952770 CTGTGGGATTTGGGGTCCAGAGG + Intronic
1163112712 19:15170964-15170986 CAGTGGGGTTGGATGCCAGGTGG - Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1163497754 19:17656446-17656468 CTGTGTGACTGGGGCTCAGGTGG - Intronic
1163668461 19:18613849-18613871 CTGGGGGAGGGGAGGACAGGGGG - Intronic
1163857947 19:19720780-19720802 CTGTGGGATTATAGGGTAGGTGG - Intronic
1164387275 19:27783677-27783699 CTGAGGGACTGGCTGTCAGGGGG + Intergenic
1164902364 19:31938921-31938943 CTGTGGGATTGGGGGGTTGGGGG + Intergenic
1165001612 19:32768124-32768146 TTGTGGGATTGTGGGACAGGTGG - Intronic
1165350216 19:35271167-35271189 CTGTGAGGGTGGTGGTCAGGGGG - Intronic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
1166822193 19:45587507-45587529 CTATGGGAATGGAGGTGATGGGG - Intronic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1168362974 19:55758363-55758385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
1168363929 19:55768363-55768385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
925267864 2:2579846-2579868 CTGAGAGATTGGAGAGCAGGTGG - Intergenic
926132256 2:10311157-10311179 CTGAGGGATTGGGGGGCGGGGGG - Intronic
927062403 2:19436211-19436233 TTCTGGGATTGGAGGTAAGGAGG - Intergenic
928176841 2:29039713-29039735 CTCTGGGATTGGGGCTCAAGTGG + Intronic
928877537 2:36057583-36057605 CTGTGAAATTGGAGGTCATGAGG + Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
930606670 2:53500147-53500169 GTGTGGGATTGGAGCGCAAGGGG - Intergenic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
934754880 2:96817783-96817805 CTGGGGGATTAGAGGACAAGCGG - Intronic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
937166937 2:119828173-119828195 CTGTTGGCTGGGAGGTCAGCTGG - Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
940844511 2:158625153-158625175 CGTTGGGATTGGAGGTCTGCCGG - Exonic
941191793 2:162393312-162393334 ATGTGGGACTGAAGCTCAGGTGG + Intronic
941288691 2:163647557-163647579 CTGTGTGATCTGAGGCCAGGTGG - Intronic
941759585 2:169226774-169226796 ATGTGGGGTTGGAGGTCTTGTGG - Intronic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
945008461 2:205435876-205435898 CTGTGGAATAGCAGGTCTGGAGG - Intronic
947312297 2:228817946-228817968 CTGTGGTAGTGGAGGCCATGGGG - Intergenic
948053571 2:234995574-234995596 CTGTGGGCTTCGAGGACAGGAGG - Intronic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1169021249 20:2332806-2332828 TTGTGGGAGTGGGGGTGAGGTGG - Intronic
1169362315 20:4961416-4961438 CTGGGGGATTGGAGATAAAGAGG - Intronic
1169778048 20:9277505-9277527 ATCTGGCATTGGAGGTCAGATGG - Intronic
1170154643 20:13258281-13258303 CTGTGGGGTTGGAAGTAAGGTGG - Intronic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1172097266 20:32466560-32466582 CTGGGGGAGGGGAGGCCAGGAGG + Intronic
1172122409 20:32606240-32606262 GTGTGGCTTTGGAGCTCAGGGGG - Intronic
1172407426 20:34700084-34700106 CTGCAGGACTGGAGGTCAAGAGG - Intronic
1173837655 20:46136337-46136359 CTGGGAAATTGGGGGTCAGGAGG + Intergenic
1173918245 20:46725556-46725578 CTGAGGGATTGCAGGACAGCAGG - Exonic
1173922692 20:46758047-46758069 GTGTGGGAATGGAGCTCTGGGGG + Intergenic
1175525791 20:59632472-59632494 CTGTGGGCTTGGAGTGCTGGTGG + Intronic
1175764315 20:61582224-61582246 CTCTGTGATTGGAGGTGGGGAGG - Intronic
1176382698 21:6121121-6121143 CTGTGGGAACAGAGGACAGGTGG - Intronic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1179355037 21:40651152-40651174 CTGTGTGCTTGGAGCTCATGAGG - Intronic
1179740771 21:43417118-43417140 CTGTGGGAACAGAGGACAGGTGG + Intronic
1181635027 22:24170553-24170575 CTGTGGGAGTGCGGGGCAGGAGG - Intronic
1181969235 22:26677779-26677801 CTGTTGGAAAGAAGGTCAGGAGG + Intergenic
1183241606 22:36661740-36661762 CTCTAGGATTGGAGGCAAGGTGG + Intronic
1183379134 22:37482064-37482086 CTGAGGCATAGGAGGCCAGGAGG + Intronic
1183731666 22:39621891-39621913 CTCTGGGATTGGAGGGGATGAGG - Intronic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1185303850 22:50101129-50101151 CTGGGGGGTGGGAGGTCTGGGGG + Intronic
950086192 3:10259696-10259718 CTGGGGGATTGGAGTTCCTGGGG + Intronic
952100636 3:30008721-30008743 CTGTGGCATTGGAAGACAGTTGG + Intronic
953829461 3:46282950-46282972 CTGTGGCAAAGTAGGTCAGGTGG + Intergenic
954744270 3:52778159-52778181 CTGTGGGATATGAGGTGAGATGG - Intronic
957719655 3:83977711-83977733 CTATGGGAATGGGGGTCATGTGG - Intergenic
958028902 3:88083084-88083106 CAGTAGGATTGGTGGTGAGGAGG - Intronic
958609265 3:96403212-96403234 GTGGGTGATTGGAGGACAGGTGG + Intergenic
959122425 3:102248384-102248406 GTGTGGGAAACGAGGTCAGGAGG + Intronic
959739088 3:109695322-109695344 CTGTGAGCTTGGAGCTGAGGAGG - Intergenic
959828995 3:110837486-110837508 CTAAGGGACTGGAGGTTAGGGGG - Intergenic
960690900 3:120345930-120345952 CTGTTGGATTTGTGATCAGGAGG - Intronic
960761137 3:121074865-121074887 ATGTGTGATTGGAGGACAGCAGG - Intronic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG + Intergenic
961866706 3:129958694-129958716 CTGTAGGATTGGAACTGAGGTGG + Intergenic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962828352 3:139119143-139119165 CTGTGGCCATGGAGGTCAGGTGG + Intronic
963005634 3:140724129-140724151 CTGTGGGCTTTCAGGTGAGGAGG - Intergenic
963835450 3:150054285-150054307 CTGTGGGCTGAGAGCTCAGGAGG + Intergenic
965620945 3:170641839-170641861 CTGTGGAATTTGAGTTGAGGTGG + Intronic
966720434 3:183057138-183057160 CTGTGGTATTGGGGATGAGGAGG - Intronic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
968515273 4:1013029-1013051 CTGGGGGACTGGGGGTCTGGGGG - Intronic
968950491 4:3688867-3688889 CTGTGGGATGTGAGGGCTGGTGG - Intergenic
969603527 4:8190444-8190466 CTATGGGATTGGAGGTCCTGGGG + Intronic
971452298 4:26811463-26811485 CAGTGGAATTGGAGGTGACGAGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
972152961 4:36118167-36118189 CTGTAGCATTGAAAGTCAGGAGG - Intronic
972578901 4:40377752-40377774 CTGCGGGATTGGAGTAGAGGAGG - Intergenic
974223450 4:59006673-59006695 CTTTGGGAGTCCAGGTCAGGAGG + Intergenic
975478821 4:74855015-74855037 AGGTGGAATTGCAGGTCAGGAGG + Intergenic
975655572 4:76637998-76638020 AACTGGGATTGGAGGTTAGGTGG + Intronic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
982560410 4:156922729-156922751 CTGTTGGGTTGGGGGTCGGGGGG + Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984850621 4:184149476-184149498 GTGTGGGATTGGAAACCAGGTGG + Intronic
985574162 5:665878-665900 CTGGGGGAGGGGTGGTCAGGAGG - Intronic
986391376 5:7290516-7290538 CTTTTGGATTTGAGGGCAGGGGG + Intergenic
986546743 5:8906012-8906034 CTGTGGGACAGCAGGTGAGGGGG - Intergenic
988428368 5:31090550-31090572 CTGTGGGAATGGAGGCCCTGAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992254132 5:74904731-74904753 CTGGGGGATGGGAGGCTAGGGGG - Intergenic
993999077 5:94756383-94756405 CTGTGGGATTTGACATTAGGTGG + Intronic
996629110 5:125606517-125606539 CTGTGACATTCGAGGACAGGAGG - Intergenic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
998058211 5:139097145-139097167 CTGTGGTATTGCAGCTGAGGTGG - Intronic
998396079 5:141818937-141818959 CAATGGGATTGGAGGCCAGTGGG + Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001679288 5:173544343-173544365 CTGGGGGATGGAAGGGCAGGTGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002272382 5:178081113-178081135 GTCTGGGAAGGGAGGTCAGGAGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002944172 6:1745096-1745118 CTGCGGGATTAGATGTAAGGGGG + Intronic
1003435747 6:6086472-6086494 CTGGGGGATTGCAGCTGAGGAGG - Intergenic
1004286946 6:14329982-14330004 CTCAGGGATTGGAGTTCAGAGGG + Intergenic
1004374439 6:15079402-15079424 CCGTGGGGTCGGAGGTCAGTAGG - Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1004709568 6:18156212-18156234 CTCTGGGATTGGAGACCTGGAGG + Intronic
1006848135 6:37077621-37077643 CTGTGTGGCTGCAGGTCAGGAGG - Intergenic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1009865023 6:69386728-69386750 ATGTGTGGTTGGAGGTCTGGTGG - Intronic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1011587321 6:88940585-88940607 CTGGGGGCTGGGATGTCAGGTGG + Intronic
1012096593 6:94970236-94970258 TTCTGGGGGTGGAGGTCAGGAGG + Intergenic
1015462990 6:133514964-133514986 CTGTGATATTTGAGGTCTGGAGG - Intronic
1016731793 6:147435487-147435509 CTTTGGGAAAGGAGGTGAGGAGG - Intergenic
1016894867 6:149041760-149041782 GTGTGGGAATGGAGGCCTGGAGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018840637 6:167514186-167514208 CTGGGGGAATGGAGGCCTGGCGG + Intergenic
1018840760 6:167514478-167514500 CTGGGGGACTGGGGGTCTGGGGG + Intergenic
1019517148 7:1445073-1445095 CCGTGGGAGTGGGGGCCAGGCGG + Exonic
1019761469 7:2815810-2815832 CTCTGGGATTGGACGTCATCAGG - Intronic
1020014164 7:4821247-4821269 CTGTGGGGTGGGCTGTCAGGCGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1021825316 7:24545012-24545034 CTATGAGATTGGATGGCAGGTGG - Intergenic
1022585366 7:31603720-31603742 CTGTGGGAGAGGAAGTAAGGTGG - Intronic
1023901535 7:44484787-44484809 ATGTAGGATGGGAGGTCAGTTGG - Intronic
1023987116 7:45103197-45103219 GTGTGGCATGGGAGGGCAGGGGG - Intronic
1024492666 7:50003421-50003443 CTGTGCCACTGGAGGTGAGGTGG - Intronic
1024598059 7:50956317-50956339 CTGTGGGGTGGCAGGTCGGGAGG + Intergenic
1026513512 7:71047220-71047242 CTGTGGGATTCCAAGACAGGAGG + Intergenic
1029055132 7:97733149-97733171 CAGGGGGATTGGAGGGCCGGAGG + Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029359159 7:100075686-100075708 CTGTGGGTTGGGAAGTCAGCAGG - Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029588239 7:101489219-101489241 CTGTGGGATTGGAGGAGCTGTGG + Intronic
1031883701 7:127223706-127223728 CCGTGGGAGTGGAGGTCACATGG + Intronic
1031970748 7:128063184-128063206 CTGAGGGATGGGTGGTGAGGAGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033480441 7:141735001-141735023 CTTAGGGATGGGAGGCCAGGCGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034351300 7:150416520-150416542 ATGTGTGATTGGAGGACAAGAGG - Intergenic
1036690481 8:10941666-10941688 CTGTAGGCTCTGAGGTCAGGAGG - Intronic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037431213 8:18815307-18815329 TTGTGGGGTTGGAGGTGTGGGGG + Intronic
1037989665 8:23311859-23311881 CTGTCGGGTAGGTGGTCAGGAGG + Intronic
1042524836 8:69753315-69753337 CTGGGGCATGGGAGGCCAGGGGG + Intronic
1042723755 8:71850336-71850358 CTTTAGAATTGGAGGTCAGAGGG - Intronic
1042782737 8:72509961-72509983 CTGTGGGATTGAAGGCGAGCAGG - Intergenic
1043499369 8:80837847-80837869 CTGTGGCAGTGGCAGTCAGGGGG - Intronic
1048205004 8:132408393-132408415 CAGCTGGATTGAAGGTCAGGGGG - Intronic
1048934573 8:139344243-139344265 CTGGGTGAGTGGAGGTCAAGGGG + Intergenic
1049255492 8:141611569-141611591 GAGTGGGCTTGGAGGTCAGGAGG - Intergenic
1049298540 8:141856598-141856620 CTGTGGGCTGGAAGGGCAGGAGG + Intergenic
1049361031 8:142212724-142212746 TCGTGGGCTTGGAAGTCAGGTGG - Intronic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1054761476 9:69008145-69008167 CTGTGCACTTGGAGGGCAGGAGG + Intronic
1056730990 9:89166569-89166591 CTGCGGGGAGGGAGGTCAGGCGG + Intronic
1056958916 9:91104659-91104681 CCCTGGGATTGGAGGTGGGGAGG + Intergenic
1057205329 9:93168642-93168664 ATGTGGGGTTGGAGGTTGGGGGG - Intergenic
1057413933 9:94844834-94844856 CCGTGGGAGTGGGGTTCAGGTGG + Intronic
1057880885 9:98791913-98791935 CTCTGGGAGTGGAGGTCAAGAGG - Intronic
1060385955 9:123228457-123228479 GTGTGGGGTTGGGGGACAGGGGG + Intronic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061063493 9:128262998-128263020 TGGTGGGATGGGAGGTCTGGGGG - Intronic
1061399786 9:130362069-130362091 CGGTGGCATTGCAGGTCAGCCGG - Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062480283 9:136747878-136747900 CTGGAGGGTTGGAGGTCTGGGGG - Intronic
1186905174 X:14102876-14102898 GTGGGGGATGGGAGGGCAGGTGG - Intergenic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1188545807 X:31305448-31305470 CTGATGCATTGGAGGTCAGGAGG - Intronic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1190567977 X:51750574-51750596 GTGAGGGTTTGAAGGTCAGGAGG + Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1193461951 X:81801466-81801488 TTCTGGGATTGGAGGTGAGCAGG + Intergenic
1195539632 X:106047924-106047946 CTGTGGGAATGGAAGTTAGGAGG - Intergenic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1196495405 X:116318421-116318443 CTGTGGGAGTGGTGGCCATGGGG + Intergenic
1197280503 X:124529955-124529977 CTGTGTGATTCGAGGCCAAGTGG - Exonic
1197913136 X:131507159-131507181 TTGTGGGATTGGGGGGCAAGGGG + Intergenic
1199608631 X:149595513-149595535 CTTTGGGATTGGATGCTAGGAGG + Intergenic
1199630491 X:149773847-149773869 CTTTGGGATTGGATGCTAGGAGG - Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200104033 X:153702573-153702595 GTGTGGGAGTGGCGTTCAGGAGG - Intronic
1202052551 Y:20796329-20796351 GTGTGTTATTGGAGGTCAGGAGG - Intergenic