ID: 1067079649

View in Genome Browser
Species Human (GRCh38)
Location 10:43205817-43205839
Sequence GTCCAGCTCTACCACTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067079644_1067079649 -9 Left 1067079644 10:43205803-43205825 CCTCCTGCAGCCCTGTCCAGCTC 0: 1
1: 0
2: 2
3: 70
4: 598
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079643_1067079649 -8 Left 1067079643 10:43205802-43205824 CCCTCCTGCAGCCCTGTCCAGCT 0: 1
1: 1
2: 9
3: 60
4: 499
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079632_1067079649 27 Left 1067079632 10:43205767-43205789 CCCTAGAGGTGGGCCTGGGCCCC 0: 1
1: 0
2: 4
3: 18
4: 254
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079641_1067079649 -3 Left 1067079641 10:43205797-43205819 CCTGCCCCTCCTGCAGCCCTGTC 0: 1
1: 0
2: 15
3: 162
4: 1407
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079642_1067079649 -7 Left 1067079642 10:43205801-43205823 CCCCTCCTGCAGCCCTGTCCAGC 0: 1
1: 0
2: 10
3: 92
4: 568
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079638_1067079649 5 Left 1067079638 10:43205789-43205811 CCCACTGCCCTGCCCCTCCTGCA 0: 1
1: 0
2: 7
3: 86
4: 700
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079639_1067079649 4 Left 1067079639 10:43205790-43205812 CCACTGCCCTGCCCCTCCTGCAG 0: 1
1: 2
2: 21
3: 148
4: 1276
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079633_1067079649 26 Left 1067079633 10:43205768-43205790 CCTAGAGGTGGGCCTGGGCCCCC 0: 1
1: 0
2: 2
3: 31
4: 354
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079635_1067079649 8 Left 1067079635 10:43205786-43205808 CCCCCCACTGCCCTGCCCCTCCT 0: 1
1: 2
2: 17
3: 233
4: 2045
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079634_1067079649 14 Left 1067079634 10:43205780-43205802 CCTGGGCCCCCCACTGCCCTGCC 0: 1
1: 1
2: 17
3: 129
4: 1047
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079640_1067079649 -2 Left 1067079640 10:43205796-43205818 CCCTGCCCCTCCTGCAGCCCTGT 0: 1
1: 0
2: 8
3: 118
4: 839
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079636_1067079649 7 Left 1067079636 10:43205787-43205809 CCCCCACTGCCCTGCCCCTCCTG 0: 1
1: 0
2: 11
3: 142
4: 1340
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1067079637_1067079649 6 Left 1067079637 10:43205788-43205810 CCCCACTGCCCTGCCCCTCCTGC 0: 1
1: 0
2: 11
3: 170
4: 1325
Right 1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067079649 Original CRISPR GTCCAGCTCTACCACTCTGT GGG Intronic
904420909 1:30390718-30390740 ATACAGTTCTACCACTCGGTAGG - Intergenic
909952653 1:81737755-81737777 TTCCAGAGCTACCATTCTGTTGG - Intronic
913193662 1:116434306-116434328 GTCCTGCTTAACCACACTGTGGG + Intergenic
917249975 1:173048186-173048208 TCTCACCTCTACCACTCTGTGGG + Intronic
919900726 1:202042558-202042580 GGGCAGCTCTGCCACTCTGCAGG + Intergenic
920305696 1:205016741-205016763 CTCCAGCTCTCCCACACTGGTGG - Exonic
922680483 1:227591224-227591246 GTCCAGCTCTATCAATTTTTAGG + Intronic
923051507 1:230393970-230393992 TTCCAGCTCTCCCACTCTTCTGG + Intronic
1063174739 10:3541028-3541050 GGCAAGCTCTAACACTGTGTGGG - Intergenic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1068556835 10:58467584-58467606 TTCCAATTCTACCCCTCTGTGGG - Intergenic
1069373545 10:67771256-67771278 GTCCATCACAACCACTCTCTGGG - Intergenic
1070729720 10:78818153-78818175 GCCCAGCTCCACCACTGAGTGGG + Intergenic
1073768220 10:106707016-106707038 CTCCAGCTCTGCCACTGTTTGGG - Intronic
1077669182 11:4142254-4142276 GACCAGCTCTCCCACCCTGAGGG + Intergenic
1081984561 11:47292281-47292303 TTCCAGCTCTAACATTCTGCAGG + Intronic
1084104386 11:66971517-66971539 GACCAGCTCTGCCACTTAGTGGG + Intergenic
1084591660 11:70094068-70094090 GGCCAGCTCTGTCCCTCTGTGGG - Intronic
1085363719 11:75917560-75917582 CTCTAGCTCTACCTCTCTTTTGG + Intronic
1089911853 11:122108804-122108826 GCCCAACTCTACCAATTTGTAGG + Intergenic
1091305496 11:134533289-134533311 GCCCAGATCTCCCACTGTGTAGG - Intergenic
1091644887 12:2265800-2265822 ACCCAGCTCTCCCTCTCTGTGGG - Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1094426446 12:30321491-30321513 TACCAGGTCTACCACTCTTTGGG - Intergenic
1102343465 12:112142206-112142228 GTCCTGCTCTGCCACACTGGAGG - Exonic
1112381900 13:98899326-98899348 ATCCAGCTGTATGACTCTGTAGG + Intronic
1113982512 13:114288350-114288372 CTCCAGCTCCACCACTATCTTGG - Intronic
1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114535540 14:23419959-23419981 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1117026084 14:51621511-51621533 GTCCTGCTGTTCCACCCTGTAGG + Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119613812 14:76085177-76085199 TTCCAGCTCTGCCACTCAGCTGG - Intergenic
1120757852 14:88260600-88260622 TACCAGCTCTACCACTTTGGTGG + Intronic
1122120499 14:99550908-99550930 GTCCAGCTCGACCAAGCTGCTGG + Intronic
1125716909 15:41824552-41824574 GTGCGGCTCTACCACTCGGTGGG + Exonic
1132574501 16:658295-658317 ATCCAGCACCACGACTCTGTTGG - Exonic
1134643727 16:15849924-15849946 GCCCAGCTCTACCATTTTATGGG + Intronic
1135999528 16:27281101-27281123 TTCCATCTCTTCCCCTCTGTCGG + Intronic
1136633704 16:31505510-31505532 GGCCAGCCCTTCCACACTGTGGG - Intronic
1139442645 16:66976446-66976468 GTCAAGCTCTACCAGCTTGTGGG - Intergenic
1143594912 17:7908323-7908345 CTCCATCTCTACCTGTCTGTTGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1151472839 17:74328444-74328466 CTCCAGCTCTGCCACGCTGATGG - Exonic
1157293206 18:46424545-46424567 GTCCAGCTCTAGGACCCTGGCGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1167060972 19:47146107-47146129 TTCCATTTCTACCACACTGTAGG - Intronic
927819975 2:26255572-26255594 TTCCAGCTCTACCTCTTTCTGGG + Intronic
928299670 2:30114092-30114114 GGCCAGCTCCACCATTCTCTGGG + Intergenic
928376608 2:30779479-30779501 GTCCAGCTTTACAAGGCTGTTGG - Intronic
933492153 2:82999147-82999169 GTCATGCTCTACCTCTCTGAGGG + Intergenic
933764481 2:85697438-85697460 GCCCAGCTCTGCCACCCTGCAGG - Intronic
935898996 2:107770515-107770537 GTCCAGCTGTAGCACCCAGTGGG + Intergenic
936001543 2:108835950-108835972 CTCCTGCTCTTCCACCCTGTGGG - Intronic
938768185 2:134477820-134477842 GTACAGCTTCACCACTCTGTGGG - Intronic
939023335 2:136984192-136984214 GTACAGCTTCACCACTCTGTGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
941862198 2:170294818-170294840 GTTCAGTTGTACCACTCTGGTGG + Intronic
942702264 2:178726161-178726183 GTCCAGCACTAACACTCTCATGG + Intronic
1178718789 21:34990376-34990398 GTGCAGCTCTGCCATTCTGGGGG - Intronic
1179005727 21:37512366-37512388 GTCCAGCTATGCCAGTCTCTTGG - Exonic
1179847302 21:44118843-44118865 GTCCATCTCTACCACCCAGGCGG - Intronic
950627646 3:14259851-14259873 TTCCAGCTTGACAACTCTGTTGG + Intergenic
952834281 3:37590696-37590718 GTCCCCCTTTCCCACTCTGTGGG + Intronic
961454021 3:127015479-127015501 GCCCAGTCCTACCACTCTGGAGG - Intronic
962090301 3:132237465-132237487 GCCCAGATTTCCCACTCTGTTGG + Intronic
962538023 3:136348728-136348750 TTCCAGTTCTACCACTTGGTTGG - Intronic
965357259 3:167691828-167691850 ATCCAGCTCTACCACTTAATAGG + Intronic
969232242 4:5839852-5839874 GCCCAGCTCCACCACATTGTCGG + Intronic
970197823 4:13570367-13570389 TTCCAGCTCTACCACACTCTAGG + Intronic
970288059 4:14540045-14540067 GTCCAGTTCTACACCTTTGTTGG - Intergenic
974085405 4:57255418-57255440 TTTCAGCTCTACCACTTTCTGGG - Intergenic
977310774 4:95384519-95384541 GTCCAGCTTTACCACACTCCTGG - Intronic
979950201 4:126883114-126883136 GTCCAACTTTTCCACTCTATAGG + Intergenic
985006816 4:185542424-185542446 GTCCTGCTCTACCACTCTCCAGG - Intergenic
990630452 5:57663102-57663124 GTCTAGCTGTACCACTCACTAGG + Intergenic
992192805 5:74310632-74310654 GTCCAGCTCCACCTCTCCTTGGG - Intergenic
992623206 5:78613782-78613804 ATCCAGCTCTACCACTTACTTGG + Intronic
992664159 5:78989522-78989544 GTACAGATGTACCACTCTGGTGG + Intergenic
997114354 5:131110155-131110177 GTGCTGCTCTGCCCCTCTGTGGG + Intergenic
998050116 5:139025328-139025350 TTCCAGCTCTACCACTCACTAGG + Intronic
998186206 5:139981769-139981791 GTCTGGCTCTACCAGGCTGTGGG + Intronic
998847286 5:146323334-146323356 TTCCAGCTGTACCCCTCTGAAGG - Intronic
1001717505 5:173828646-173828668 GTCCCTTCCTACCACTCTGTAGG + Intergenic
1003095530 6:3140213-3140235 TTCCAGCTCTAACATTCTTTGGG - Intronic
1003105295 6:3210680-3210702 GACCAGCTGTGCCAGTCTGTAGG + Intergenic
1006600917 6:35225274-35225296 ATCCAGCTCTACCCTTCTCTAGG - Intronic
1009534262 6:64860721-64860743 TTTCAGCTCTGCCACTCAGTGGG + Intronic
1014425167 6:121295592-121295614 GTCAAACTCTTCCCCTCTGTTGG - Intronic
1017655367 6:156622644-156622666 GTACAGCTCTACCACTGGTTAGG - Intergenic
1023435032 7:40134034-40134056 GTACGGCTCTGCCACTCTTTCGG + Intronic
1023585074 7:41720750-41720772 GTCTAGCTCTGCCACTGTATAGG - Intergenic
1023612081 7:41981541-41981563 GTCCAGCTCCTCCAGTGTGTTGG - Intronic
1026911775 7:74095270-74095292 GTCCCGCTCTGCCACTGTTTGGG - Intronic
1027745270 7:82065346-82065368 GTCCAGGTATGCCACTCAGTGGG + Intronic
1028915491 7:96254301-96254323 TTCCAGCTCTAACACTCAGGTGG - Intronic
1032080876 7:128857913-128857935 GGCCAGCACTGCCACCCTGTGGG - Intronic
1032091373 7:128913247-128913269 GGCCAGCACTGCCACCCTGTGGG + Intergenic
1032455194 7:132067878-132067900 GTCTAGCTCTGCCACTCACTAGG - Intergenic
1033390541 7:140924222-140924244 ATCCAGCTCTGCATCTCTGTGGG - Intronic
1039952257 8:42181548-42181570 GACCACCTCCACCACGCTGTTGG + Intronic
1045549820 8:103161635-103161657 GCCCAGCTGTACCACTTTTTAGG - Intronic
1047452167 8:124974333-124974355 GTCCTGCTCTACCACTTTCTAGG + Intronic
1049550864 8:143258839-143258861 GGCCATCTTTACCACGCTGTGGG - Intronic
1056399545 9:86213182-86213204 TTCCAGCTCTAACACTGTGAGGG - Intergenic
1057140260 9:92722510-92722532 GGCCAGCTTTACCACTGTGGAGG - Intronic
1058117368 9:101099462-101099484 ATCCAGCTCTCCCTGTCTGTGGG + Intronic
1059647220 9:116279457-116279479 TTCCAGCCCTGCCTCTCTGTGGG - Intronic
1059989640 9:119853128-119853150 GTCCTGCTCTCCCCCTCTCTGGG - Intergenic
1060301279 9:122375908-122375930 GTCTAGTTCTACCACTCTAAGGG - Intronic
1060750563 9:126165793-126165815 GTCCAGCTTTTCCACTGGGTGGG - Intergenic
1061001280 9:127904370-127904392 GGCCAGCTCTCCCAGACTGTGGG - Intronic
1061774466 9:132951697-132951719 GTCCAGCTCCTCCTCTGTGTGGG + Intronic
1186241301 X:7569593-7569615 GTGCAGCTATTCAACTCTGTTGG + Intergenic
1186990859 X:15065894-15065916 GACCAGCTCTCCCTCTCTGTTGG + Intergenic
1187764486 X:22625210-22625232 GTCCATCTTTATCACTATGTAGG + Intergenic
1189355510 X:40307311-40307333 GTCCAGCTCTCCAACACTGAAGG + Intergenic
1189452744 X:41154143-41154165 GTCTAGCTCTAACAATCTATTGG - Intronic
1189588778 X:42489711-42489733 TTCCAGCTCTATCATTGTGTGGG - Intergenic
1192017513 X:67347405-67347427 GACCAGCTCTACTACAATGTGGG + Intergenic
1193866618 X:86739839-86739861 GTCCAGCTCTCCCTCTCAGATGG + Exonic
1195858624 X:109357385-109357407 TTCCAGCTCTGCCATTCTGTGGG + Intergenic
1197332445 X:125170650-125170672 GACCAGCTCTCCCACCCTATGGG + Intergenic
1198512051 X:137361937-137361959 GTACAGCTATACCACAGTGTTGG + Intergenic
1200213459 X:154357035-154357057 CTCCAGCTCTTCCCCTCTCTGGG - Intronic