ID: 1067081019

View in Genome Browser
Species Human (GRCh38)
Location 10:43212216-43212238
Sequence GCTGTTGTTGGAACACATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067081014_1067081019 -1 Left 1067081014 10:43212194-43212216 CCCAGAGATGCCTGGGATGCCAG 0: 1
1: 1
2: 9
3: 148
4: 447
Right 1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG No data
1067081015_1067081019 -2 Left 1067081015 10:43212195-43212217 CCAGAGATGCCTGGGATGCCAGC 0: 1
1: 0
2: 1
3: 100
4: 387
Right 1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG No data
1067081012_1067081019 3 Left 1067081012 10:43212190-43212212 CCTCCCCAGAGATGCCTGGGATG 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG No data
1067081013_1067081019 0 Left 1067081013 10:43212193-43212215 CCCCAGAGATGCCTGGGATGCCA No data
Right 1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067081019 Original CRISPR GCTGTTGTTGGAACACATCC CGG Intronic
No off target data available for this crispr