ID: 1067081575

View in Genome Browser
Species Human (GRCh38)
Location 10:43215477-43215499
Sequence GATCCTGGTGGGCCTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067081566_1067081575 9 Left 1067081566 10:43215445-43215467 CCTGGAGGGAGCTGGGGGCAGCC 0: 1
1: 8
2: 27
3: 205
4: 1988
Right 1067081575 10:43215477-43215499 GATCCTGGTGGGCCTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067081575 Original CRISPR GATCCTGGTGGGCCTCAGGA GGG Intronic
No off target data available for this crispr