ID: 1067082781

View in Genome Browser
Species Human (GRCh38)
Location 10:43221084-43221106
Sequence TCACTCCTCTTCTCCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 405}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082781_1067082786 -2 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082786 10:43221105-43221127 GATCCCATCCCTCCACCCGGGGG No data
1067082781_1067082783 -5 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082783 10:43221102-43221124 AGTGATCCCATCCCTCCACCCGG No data
1067082781_1067082784 -4 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082784 10:43221103-43221125 GTGATCCCATCCCTCCACCCGGG No data
1067082781_1067082785 -3 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082785 10:43221104-43221126 TGATCCCATCCCTCCACCCGGGG No data
1067082781_1067082795 22 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082795 10:43221129-43221151 CTGCGGTCCCTCTGCTCTGAAGG No data
1067082781_1067082797 29 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082781_1067082789 5 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082789 10:43221112-43221134 TCCCTCCACCCGGGGGTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082781 Original CRISPR TCACTCCTCTTCTCCCAGCA GGG (reversed) Intronic
900192251 1:1356490-1356512 TGACTCCTCTTCCCCTACCAGGG - Intronic
900420147 1:2552759-2552781 ACACTCCTCTGCTCCCCCCAGGG + Intergenic
900424284 1:2568899-2568921 ACACTCCTCTGCTCCCCCCAGGG - Intergenic
900653830 1:3745212-3745234 TCACTCCGTTCCTGCCAGCAGGG + Intergenic
901271656 1:7956620-7956642 TCACTCCCCTTCCACCTGCATGG - Intronic
901568568 1:10139982-10140004 TCACACCTGTAATCCCAGCAAGG - Intronic
901705871 1:11072659-11072681 TCTCTCCTCTTTTCCCCCCACGG - Intronic
901745807 1:11372787-11372809 TCTCTGCTCTTCTTCCAGCATGG - Intergenic
902299890 1:15494203-15494225 TAATTCCTGTTTTCCCAGCAAGG + Intronic
902341051 1:15783926-15783948 TCACACCTGTAATCCCAGCATGG + Intronic
902714977 1:18266511-18266533 TCACTCCTGTTGTCCCAGTGAGG - Intronic
903285196 1:22272703-22272725 TCACTCCTTTCCTCCCACCTGGG + Intergenic
903656908 1:24955092-24955114 TCACTCTGCTTGTACCAGCAAGG + Intronic
905496550 1:38393595-38393617 TCCCTCTTCTTCCCCCACCAAGG + Intergenic
905508398 1:38498938-38498960 CCTCTTCCCTTCTCCCAGCAGGG - Intergenic
906019584 1:42615564-42615586 TCACACCTTTAATCCCAGCAGGG - Intronic
906088052 1:43152810-43152832 TCATACCTCGTCTCCCAGCCAGG + Exonic
906611686 1:47208363-47208385 TCCATCCTCTTCTCCCTGAAGGG - Intergenic
907497980 1:54857847-54857869 TCACTTCCCTTCCCCCAGCTTGG - Intronic
907718698 1:56951659-56951681 TCACTAATCCTCTCCCTGCAGGG + Intronic
908324075 1:63006302-63006324 TCAGTCATCCTCTCCCAACAAGG - Intergenic
908928841 1:69291196-69291218 ACACTCTTGTTCTCCCATCAAGG + Intergenic
909720021 1:78756329-78756351 CAACTCCTCTACTCCCAGCTAGG - Intergenic
912316896 1:108675492-108675514 ACACTCCTCATCTCCCAGACGGG - Intergenic
912489599 1:110054761-110054783 TCTCTCCTCTTCCCCCAGGATGG - Intronic
912966819 1:114243009-114243031 ACGCTCCTCTCCTCCCAGAAGGG - Intergenic
915952659 1:160199857-160199879 TCAAACGTCTTCTCCCAGTATGG - Exonic
915992708 1:160532514-160532536 ACACTCCTCACCTCCCAGAAGGG - Intergenic
916046091 1:161000864-161000886 GCTCTCCTCTTCCCCCAGAAAGG + Intronic
916694750 1:167222530-167222552 TCCCCCCTCTCTTCCCAGCACGG - Intronic
917649228 1:177060363-177060385 TCTTTTCTCTTCTCCCAGCCAGG - Intronic
918198596 1:182246005-182246027 TCATTCCTCTTTTTCCAGGAAGG - Intergenic
920686146 1:208110339-208110361 TCCCTCACCTGCTCCCAGCAGGG - Intronic
922010256 1:221576388-221576410 TCAGAGCTCTTCACCCAGCAAGG + Intergenic
922986646 1:229871245-229871267 TCTATCCTCTTCTCCCAGGAGGG - Intergenic
924128092 1:240876564-240876586 TCACTCTTCTTTTGCCAGAATGG - Intronic
1063351047 10:5355335-5355357 TCACTCATCTTCTGCCTCCATGG - Intergenic
1064781401 10:18842917-18842939 TCACACCTGTAATCCCAGCAAGG - Intergenic
1064960808 10:20963213-20963235 TCACCCTCCATCTCCCAGCATGG + Intronic
1066257951 10:33699557-33699579 TTCCTCTTCTTCTTCCAGCATGG + Intergenic
1067059344 10:43069953-43069975 TCTCTGCTCTCCTTCCAGCAGGG + Intergenic
1067082781 10:43221084-43221106 TCACTCCTCTTCTCCCAGCAGGG - Intronic
1067111353 10:43403272-43403294 TCACACCTTTAATCCCAGCAGGG - Intronic
1067334170 10:45347515-45347537 GCACTCCTCATTTCCCAGAAGGG - Intergenic
1070428064 10:76308645-76308667 TCACCTCTCTCCTCCCAGCCTGG + Intronic
1071524312 10:86349286-86349308 TCTCTTCTCTTCTCCCACCTGGG - Intronic
1071985920 10:91050212-91050234 TGACTCCTCTTCTTCCTGGAAGG - Intergenic
1072306351 10:94111284-94111306 TCACTCCACCTCTGCCCGCAAGG - Intronic
1073323491 10:102629515-102629537 CCACTCTTCTGCTCCCACCAAGG + Intronic
1074755087 10:116618506-116618528 TCACGCCTGTAATCCCAGCAAGG - Intergenic
1074770702 10:116731762-116731784 TAACTCCCCCTCTCTCAGCAAGG + Intronic
1076623139 10:131805880-131805902 CCACTCCTCTTGCCCCCGCAGGG - Intergenic
1076770463 10:132660212-132660234 TAAATCCTCTTCTTCCAGCATGG + Intronic
1076812831 10:132898205-132898227 TGCCTCCCCATCTCCCAGCAGGG + Intronic
1077195786 11:1279314-1279336 TCACTCCCCTCCTTCCTGCAGGG + Intronic
1077540139 11:3142808-3142830 TCACTGCCCTTCTACCCGCAAGG - Intronic
1077551156 11:3200891-3200913 TCATTCCTCCCTTCCCAGCAGGG - Intergenic
1078331361 11:10425121-10425143 TCACAACTCCTCGCCCAGCAAGG - Intronic
1078386181 11:10894941-10894963 TCTCTACTCTTCTTCCAGCTCGG - Intergenic
1078820094 11:14870190-14870212 TCAGTGCTATTCTCCCAGCTAGG + Exonic
1079022802 11:16923497-16923519 TCACTCATTTTCTCCCTGGAAGG + Intronic
1079103998 11:17558937-17558959 TCTCTCCTCTCCACCCAGCTGGG - Intronic
1079558797 11:21794978-21795000 ACACTGATCTTCCCCCAGCAAGG - Intergenic
1079752251 11:24213614-24213636 TCACAACACGTCTCCCAGCAAGG + Intergenic
1081588375 11:44403301-44403323 TCTCTCCTCTGCTCACGGCAAGG + Intergenic
1081979588 11:47258059-47258081 ACCATCCTCTTCTCCCAGCAAGG + Exonic
1083419789 11:62546312-62546334 TCCCACCTCCTCTCCCTGCATGG - Intronic
1084152316 11:67294771-67294793 TCACACCTGTAATCCCAGCAAGG - Intronic
1084592190 11:70097225-70097247 CCACTGCTCTTCCCCAAGCATGG - Intronic
1084705567 11:70814378-70814400 TCACCCCTACTCTGCCAGCAGGG + Intronic
1084810835 11:71610098-71610120 TCACTCCCCCTCTCCCACCCTGG + Intergenic
1085204269 11:74721227-74721249 TCAGTCCCCTCCTCCCACCAGGG + Intronic
1085443364 11:76582648-76582670 ACACTCCTCACCTCCCAGAAGGG + Intergenic
1085597367 11:77821543-77821565 CAGATCCTCTTCTCCCAGCAGGG - Intronic
1086493030 11:87374965-87374987 TCAGCCCTCTTAGCCCAGCAAGG + Intergenic
1088276827 11:108096254-108096276 GCAATCCTCTTCTCCCACCTTGG - Intronic
1088657430 11:112014030-112014052 TCACTCCTCCTCCCCAAGGAGGG + Intronic
1088741838 11:112773894-112773916 GCTCTCCTCTTCTCCCAGCAGGG + Intergenic
1088750588 11:112839090-112839112 CCACTCTGCTTTTCCCAGCAGGG - Intergenic
1089091970 11:115885770-115885792 CCACTGCTCTTCTCCCAGGGAGG + Intergenic
1089403829 11:118181186-118181208 TAACACTGCTTCTCCCAGCAGGG - Intergenic
1089485514 11:118843044-118843066 TCACGCCTGTAATCCCAGCATGG + Intergenic
1089493312 11:118896675-118896697 TCGCCCCACTTCTCCCAGCCTGG - Exonic
1089698645 11:120230958-120230980 TCCCTCCCCATCCCCCAGCAAGG - Intergenic
1090084830 11:123641738-123641760 CCTGTCCCCTTCTCCCAGCAGGG + Intronic
1090188840 11:124754883-124754905 TCACACCTCTCCCCCCATCAGGG - Intronic
1090997782 11:131882653-131882675 TCCCTCAACTTCTCCCATCATGG - Intronic
1091365503 11:135016380-135016402 ACACTCCTCTTCACACAGGAAGG + Intergenic
1091696668 12:2632545-2632567 TCCCTTCTCTTCTCCAAACATGG + Intronic
1091790618 12:3269976-3269998 TCACTCCTCTTCTACAAGGCTGG + Intronic
1092396380 12:8130641-8130663 TCACTCCTGTAATCCCAGCACGG - Intronic
1092749418 12:11704607-11704629 TCACACCTGTAATCCCAGCAAGG - Intronic
1093065583 12:14654778-14654800 TCTCTCATCTTCTCCCAGATGGG - Intronic
1093153791 12:15655802-15655824 GCTCTCCTCTTCCCTCAGCATGG - Intronic
1094498916 12:31006317-31006339 TCAGTGCCCTTCTCCAAGCAGGG + Intergenic
1095957276 12:47813912-47813934 TCCAACCTCTTCTCCCAGGAAGG - Intronic
1096184946 12:49572758-49572780 TCACGCCTATAATCCCAGCATGG + Intronic
1096370539 12:51065584-51065606 TCACACCTGTAATCCCAGCATGG - Intronic
1096808365 12:54154354-54154376 CCTCTCCTCTTCTCCCAGTGTGG - Intergenic
1096853415 12:54458631-54458653 TCACGCCTGTAATCCCAGCACGG - Intronic
1097723541 12:63049598-63049620 TCATTCCTCTTCTCCCAATATGG + Intergenic
1098013184 12:66076143-66076165 TCTCTCCTCTTCTCCCTTCTAGG + Intergenic
1100971352 12:100074333-100074355 TCACACCTGTAATCCCAGCACGG + Intronic
1101179784 12:102203071-102203093 TCACTACTCATCTACCAGAATGG - Intergenic
1101706670 12:107226753-107226775 TCACCACTGTTCTCCCACCAGGG + Intergenic
1101749941 12:107575298-107575320 TCACTCATCTTCTCCCTGCCAGG - Intronic
1102371155 12:112383027-112383049 TCACACCTGTAATCCCAGCACGG + Intergenic
1102459718 12:113093141-113093163 CCTCTTCTCTTCTCCCCGCAGGG + Exonic
1102587308 12:113932471-113932493 TCCCTCTCCTTCTCCCTGCAGGG + Intronic
1102908514 12:116695347-116695369 TTTCTTCTCTTCTCTCAGCATGG - Intergenic
1103864869 12:124043664-124043686 TCATTTCTCTTCTCACAGCAGGG - Intronic
1103895535 12:124270737-124270759 ACACTCATCTTCTCCCTGCCGGG - Intronic
1104221858 12:126792535-126792557 TCCCTCCCTCTCTCCCAGCAAGG - Intergenic
1104480432 12:129103173-129103195 TCCCTCCTCTTCCTCCAGCCTGG - Intronic
1104797256 12:131528353-131528375 TCACTCCTCATCAACCACCAGGG + Intergenic
1105035706 12:132919302-132919324 GCTCTCCTCTCCTCCCAGCTGGG + Intronic
1105462850 13:20608038-20608060 GGCCTCCTCTTCCCCCAGCACGG + Intronic
1105754154 13:23449449-23449471 CCTTTCCTCTTCTCCCAGGAAGG + Intergenic
1106433768 13:29706263-29706285 TCACTGCCCTTCTCCAAACAGGG + Intergenic
1107590708 13:41901602-41901624 TCACGCCTGTTATACCAGCACGG + Intronic
1108861458 13:54864879-54864901 TCAACCATCCTCTCCCAGCATGG - Intergenic
1108935488 13:55876212-55876234 TCAACTCTCTTCTACCAGCACGG + Intergenic
1109001832 13:56814038-56814060 GCACCCCTCTCCTCCCACCATGG - Intergenic
1109259550 13:60127720-60127742 TCAATTCTCTTCTCCCATCCTGG - Intronic
1109261052 13:60145386-60145408 TCACGCCTGTAATCCCAGCAGGG + Intronic
1109647035 13:65272401-65272423 TCACTCCCCTACTCTCAGGAAGG + Intergenic
1109805472 13:67434942-67434964 TCACGCCTGTAATCCCAGCACGG - Intergenic
1110341579 13:74397881-74397903 TCACACCTATAATCCCAGCAGGG - Intergenic
1112033450 13:95477020-95477042 CCACGCCTCTCCTCCTAGCAGGG + Intronic
1112603464 13:100879967-100879989 TCACACCTGTTGTCCCAGCACGG + Intergenic
1113075248 13:106461632-106461654 TCACACCTGTAATCCCAGCATGG + Intergenic
1113309759 13:109120000-109120022 TCCTTCCTCTTCTCATAGCAGGG - Intronic
1113475576 13:110578445-110578467 TCCAACCTCTTCTTCCAGCATGG + Intergenic
1114962734 14:27914457-27914479 TCTCTCCTCTACCTCCAGCATGG + Intergenic
1114994702 14:28333651-28333673 TCTCTCCTCTTTGCCCACCAAGG - Intergenic
1117359520 14:54959388-54959410 TCCCTCCTCTTCCCCCCGCCAGG - Intronic
1117993735 14:61459317-61459339 TCACTCGTTTGGTCCCAGCATGG - Intronic
1119372098 14:74155369-74155391 TCACTGCTCTGCTTCCACCAGGG - Intronic
1119410001 14:74424686-74424708 TACCCCCTCTTCTCCCAGCATGG - Intronic
1121519648 14:94577267-94577289 TCACTCCTCTCCACCCAGCCAGG + Intronic
1121638318 14:95468538-95468560 TCACTCAGCATCTCCCAGGAAGG - Intronic
1121642268 14:95493652-95493674 CCACCCCTCTTCTCCCAGGCAGG - Intergenic
1122140023 14:99657492-99657514 TCCCTTCCCTTCTTCCAGCAGGG - Intronic
1122524919 14:102374909-102374931 TCACCCCTCTTCCCCCCGCAGGG - Intronic
1122844564 14:104485615-104485637 TCACTCCTCTTTTTCCATCTTGG + Intronic
1123051203 14:105544709-105544731 TCACACCACTGCACCCAGCATGG - Intergenic
1124209536 15:27751738-27751760 GCACTCCTATTCTCCCCTCAAGG - Intergenic
1125721243 15:41846119-41846141 TCACACCTCTTCCCCCTCCAGGG + Intronic
1126688149 15:51266161-51266183 TCTTTGCTCTTCTCCCAGCCTGG - Intronic
1127377965 15:58402345-58402367 TCCCTCTTCATGTCCCAGCATGG - Intronic
1128607325 15:69046801-69046823 TCTCTGCTCTACTCCCTGCAGGG + Exonic
1128901462 15:71426178-71426200 TGACACCTCTTCCCCCAGCTGGG + Intronic
1129258067 15:74345425-74345447 TCCTTTCTCTTCTCCCAGCCAGG - Intronic
1129846563 15:78770544-78770566 TCAGTCCTCCTCTCACAGCTCGG - Intronic
1130947972 15:88563332-88563354 ACACTGCCCTTTTCCCAGCATGG + Intergenic
1132347502 15:101117199-101117221 TCACTCCACTTCTCTCTCCATGG - Intergenic
1132503725 16:296592-296614 GCACTTCTCTCCTCCCAGAAGGG - Intronic
1132840640 16:1977000-1977022 TCCCCCATCTTCCCCCAGCAAGG - Intronic
1133237261 16:4393041-4393063 TCTCCCCTCCTCTTCCAGCAGGG - Intronic
1133524378 16:6589978-6590000 TCACTCCTCTTCTGATAGAAAGG + Intronic
1134169184 16:11955109-11955131 TCACACCTATAATCCCAGCATGG + Intronic
1134387092 16:13783575-13783597 TCACTCCTCCTCTCCCTTGAGGG - Intergenic
1135410331 16:22229449-22229471 TCACGCCTGTAATCCCAGCACGG + Intronic
1135973611 16:27090213-27090235 GCACTCCTCCCCTCCCAGCCAGG + Intergenic
1136175575 16:28514214-28514236 TCCATCCTCTTCTCCCTGCATGG - Intergenic
1136245423 16:28973192-28973214 TCACCCCTGTAATCCCAGCACGG + Intergenic
1138084278 16:54119534-54119556 TCCCTCCTCTGCTCCCAACCAGG + Exonic
1138199917 16:55080931-55080953 TCACACTTCTTCTGCCAGCTGGG + Intergenic
1138402663 16:56760262-56760284 TCATGCCTCTAATCCCAGCATGG + Intronic
1138729490 16:59178976-59178998 TCACTCGTATTTTCCCAGAAGGG + Intergenic
1138777899 16:59746766-59746788 TCACTCCTCTCCTGCCACCCAGG + Intronic
1138786427 16:59851984-59852006 TCACACCTCTGCTCCCTCCAGGG - Intergenic
1138787502 16:59864659-59864681 TCATTTCTCTTCTCTGAGCATGG + Intergenic
1139327830 16:66165725-66165747 TCTCTCCTGTCCTCCCCGCAAGG + Intergenic
1139355257 16:66363816-66363838 TCACTCCCCCTCTCCCAGGATGG + Intergenic
1139480518 16:67227989-67228011 CCACTCCTCGTCACCAAGCAGGG - Intronic
1139578452 16:67857340-67857362 TTCCTCCTCTTCTGCCTGCAGGG - Intronic
1139748397 16:69093029-69093051 TGCCTCCTCTGCTCCCAGGAAGG - Intergenic
1139956539 16:70695928-70695950 TCTCTCCTTTCCTGCCAGCAGGG + Intronic
1140086493 16:71801660-71801682 TCACGCCTGTTATCCCAGCAGGG + Intronic
1140414881 16:74767345-74767367 TCACTTCTCATTTCCCAGAAAGG - Intronic
1140964386 16:79950671-79950693 TCCCTCCCCTGCCCCCAGCATGG - Intergenic
1140991516 16:80217310-80217332 TCACTCATCTTCTCCCTCCAGGG + Intergenic
1142262083 16:89047842-89047864 TCACTGCTCCTCTCCTAGAACGG - Intergenic
1142621632 17:1169094-1169116 TCCCTCCTCTTTCCCCTGCAGGG - Intronic
1142875964 17:2852518-2852540 TCTCCCCTCTCCACCCAGCATGG + Intronic
1143248513 17:5505079-5505101 TGACTTCCCTTCTCCCAGCCAGG - Intronic
1143268608 17:5659107-5659129 ACCCTCCTCTTTTCACAGCAGGG + Intergenic
1143374589 17:6459773-6459795 TCCCTCCTGGTCACCCAGCACGG + Intronic
1143628886 17:8125977-8125999 GCACTCCCCTCCTCCCAGCATGG + Intergenic
1145911472 17:28545970-28545992 CCACCCCACTTCCCCCAGCAAGG + Intronic
1145936258 17:28716738-28716760 CCCCTCCTTTTCTCCCAACAAGG - Intronic
1146457853 17:33021046-33021068 GCACTGCTCCTCTCCCAGAATGG - Intronic
1147972595 17:44227640-44227662 CCACCCCTCCTCTCCCAGAAAGG + Intergenic
1148391820 17:47278322-47278344 TCACTCCTGTAATCCCAGCAGGG + Intronic
1148904687 17:50904807-50904829 CTCCTCCTCTTCCCCCAGCAGGG - Intergenic
1149781794 17:59403437-59403459 CCCCTCCCTTTCTCCCAGCAGGG - Intergenic
1150145522 17:62765937-62765959 TCACGCCTGTAATCCCAGCACGG + Intronic
1150225911 17:63524316-63524338 GCACTCCTCAGCCCCCAGCAGGG - Exonic
1150486273 17:65546070-65546092 TCCCTCCCCAGCTCCCAGCAGGG + Intronic
1150568539 17:66364507-66364529 TCTCTCCTCTTCTCCATACAGGG - Intronic
1151579265 17:74968904-74968926 TCTCTCCTCTGCTTCCAGAATGG - Intronic
1151723906 17:75873965-75873987 CCACTCCCTTTTTCCCAGCACGG - Intergenic
1152121674 17:78422745-78422767 TCACGCCTCTAATCCCAGGACGG - Intronic
1152269635 17:79316450-79316472 TCCCACCTCTGCTCCCAGCCAGG + Intronic
1152273471 17:79339664-79339686 GCACAGCTCTTCTCTCAGCAGGG - Intronic
1152386004 17:79975137-79975159 TCACTCCTCACCCTCCAGCAGGG + Intronic
1152407369 17:80105243-80105265 TCACACCTCCGCTCCCAGCAAGG - Intergenic
1152646274 17:81469960-81469982 TCAGGCCTGTTATCCCAGCATGG + Intergenic
1152675673 17:81639659-81639681 TCACGCCTGTCATCCCAGCACGG + Intronic
1152863902 17:82710952-82710974 TGACTCCACTCCTCCCAGCCGGG + Intergenic
1153262387 18:3237335-3237357 TCACGCCTGTAATCCCAGCACGG + Intergenic
1153587903 18:6642550-6642572 TCTCTCCTCTTCTCACTGCTTGG + Intergenic
1153896667 18:9568770-9568792 TCACACCTGTAATCCCAGCATGG + Intronic
1154133160 18:11752755-11752777 GCAATCCTCCTCCCCCAGCACGG - Intronic
1155133234 18:22960289-22960311 TCACACCTGTATTCCCAGCATGG + Intronic
1155364330 18:25035253-25035275 CCACTCCCCTTTTCCCTGCAGGG - Intergenic
1156545727 18:37961856-37961878 TCACTCCTCATCTCCAAGATGGG - Intergenic
1156705782 18:39880253-39880275 TCTCATCTCTTCTCCCATCACGG - Intergenic
1157583449 18:48786810-48786832 TCCTTCCTCCTCTCCCACCATGG + Intronic
1157603701 18:48912230-48912252 TCATTCCTATAATCCCAGCAAGG + Intergenic
1158446400 18:57526132-57526154 TCTCTCCTCCTTTCCCAGCATGG + Intergenic
1159407995 18:68031363-68031385 TGACTCCTCTTTACCCAACAGGG - Intergenic
1159898423 18:74019412-74019434 ACAGTCCTCATTTCCCAGCATGG - Intergenic
1159955929 18:74518612-74518634 TCATGGCTCTTCTCCCAGCCAGG - Exonic
1160231502 18:77052822-77052844 CCACTCCTCTCCACTCAGCAGGG + Intronic
1160251433 18:77206928-77206950 CGACTCCACTTCTCCCAGCAGGG - Intergenic
1160984618 19:1832598-1832620 TCACGCCTGTCATCCCAGCACGG + Intronic
1160992163 19:1864284-1864306 TCCCCCCTCTTCTCCCGGCCTGG + Intergenic
1161151317 19:2711541-2711563 TCCCTCCACTCCTCCCAGCCAGG + Intergenic
1161174983 19:2836342-2836364 TCACACCTGTAATCCCAGCACGG - Intergenic
1161303174 19:3552925-3552947 GCACTCCTCTCCTCCCAGCCTGG + Intronic
1162298356 19:9828574-9828596 TAACTGCTCTGCGCCCAGCACGG + Exonic
1162538002 19:11275558-11275580 TCACCCCTATTGTCTCAGCAGGG - Intergenic
1162852521 19:13441766-13441788 TGACTCCTCTCCTCTCACCAGGG - Intronic
1162875694 19:13619176-13619198 TTATTCCTCTTGTCCAAGCAAGG + Intronic
1163137163 19:15320620-15320642 TCACTCCTGTGCTCCCTTCAGGG + Intronic
1163317848 19:16553779-16553801 GGCCTCCTCTTCCCCCAGCACGG - Exonic
1163425498 19:17238738-17238760 TCTCTCAGCTTCTCCCACCAAGG + Intronic
1164051484 19:21588005-21588027 TAACTCTTCTTTTCCTAGCAGGG + Intergenic
1164399228 19:27891286-27891308 TCCCTCCTCTTCTCCTCACATGG - Intergenic
1164634075 19:29780042-29780064 CCACTCTTGTTCTCCCAGCCTGG + Intergenic
1165028005 19:32975791-32975813 TTACGCCTCTGATCCCAGCATGG + Intronic
1165387194 19:35517513-35517535 TCACTCTTCCACTCCCTGCAGGG - Intergenic
1165473090 19:36014610-36014632 TTTCCCGTCTTCTCCCAGCAAGG + Intergenic
1165789958 19:38485415-38485437 TCTCCCATCTTCTCCCAGGATGG + Intronic
1166355919 19:42227205-42227227 TAACTCCTGATCTCCCACCATGG - Exonic
1166471661 19:43083796-43083818 ACACCCCTCATCTCCCCGCAAGG + Intronic
1166492691 19:43272093-43272115 TCTCTTCTCTCCTCCCTGCATGG + Intergenic
1166968711 19:46547583-46547605 TCACGCCTGTAATCCCAGCAGGG + Intronic
1167764692 19:51473750-51473772 GCACTCCTCTCCTAACAGCAGGG + Intergenic
926325464 2:11781785-11781807 TGACCCCTCTGCTCCCTGCAAGG + Intronic
926651765 2:15354288-15354310 TCACCCCCCAACTCCCAGCAGGG + Intronic
927025379 2:19063570-19063592 TCGCTCCTTTTATACCAGCATGG - Intergenic
927098350 2:19765353-19765375 TCACGCCTGTAATCCCAGCAGGG + Intergenic
927748434 2:25643990-25644012 TCACTGCTATACTCCCACCAGGG + Intronic
928197016 2:29223304-29223326 GCACCCCTCTCCTCCCAGGACGG + Intronic
928329001 2:30343043-30343065 ACACTTCTCTTCTCCCACCAAGG - Intergenic
929007207 2:37407315-37407337 TCACTCCTCTTCTCTTAACCTGG + Intergenic
929137382 2:38637707-38637729 TCACGCCTGTAATCCCAGCACGG + Intergenic
929171027 2:38933636-38933658 TCACACCTGTAATCCCAGCAAGG - Intronic
929914907 2:46126794-46126816 TCACTCATCAGCTCCCAGTAAGG - Intronic
930116418 2:47722194-47722216 TCACGCCTGTAATCCCAGCACGG + Intronic
934665932 2:96170741-96170763 TCCCTTCTCTTCACCCAACATGG - Intergenic
936261914 2:110966864-110966886 GCACTCCTTTTCCTCCAGCATGG + Intronic
936373525 2:111922172-111922194 TCAACCCTCTTCCCACAGCATGG + Intronic
937059242 2:118969288-118969310 TCACCCCTCTCCCCCCAGGAGGG - Intronic
937475142 2:122208562-122208584 TCTCTTCCCTTATCCCAGCACGG + Intergenic
938052143 2:128183870-128183892 TCAGTCCTCTCCTCACAGGATGG + Intronic
940586348 2:155656795-155656817 TCACTCGTGTTCTTCCAACAAGG - Intergenic
941966936 2:171310087-171310109 TCACTCCACCTCTCCCAGGAAGG - Intergenic
942358070 2:175141251-175141273 TCCCTCCTCCTATCCCACCATGG + Intronic
945758633 2:213882900-213882922 TCGCTCCTCTTCTCCCAGGCTGG + Intronic
946026569 2:216675272-216675294 TCCCTCCTGCTCTGCCAGCATGG + Exonic
946177561 2:217930757-217930779 TCACACCTCCTCTTCTAGCATGG - Intronic
946670380 2:222096827-222096849 TCATTCATCTACTTCCAGCAGGG + Intergenic
946700222 2:222404773-222404795 TCACTCCGCATCTCCCAGGGAGG + Intergenic
948029096 2:234801651-234801673 TCACTCCTCTGGGCCCAGCAGGG - Intergenic
948088243 2:235268141-235268163 TCCCTCCTCTCCTCCCATCCTGG + Intergenic
949007088 2:241655928-241655950 TCACTCCTCTTGACCCATCCAGG + Intronic
1169123398 20:3110589-3110611 TTCCTCCTGGTCTCCCAGCAAGG + Intronic
1169236473 20:3933843-3933865 CCACTCCTCTTCTCTCGGCAGGG + Exonic
1169326593 20:4681730-4681752 CCACTCCTCTGCTCCCCGCAGGG + Intergenic
1169401960 20:5289669-5289691 TGACTCCTTTGCTCCAAGCAGGG - Intergenic
1170181233 20:13532167-13532189 TCACTCCTGTAATCCCAGCATGG - Intronic
1172222001 20:33280468-33280490 TCCCTCCTCCTCTCCCAGGGAGG - Intronic
1172680289 20:36708768-36708790 TCACGCCTGTAATCCCAGCACGG + Intronic
1174618341 20:51854131-51854153 TCACGCCTGTAATCCCAGCATGG + Intergenic
1175451883 20:59076328-59076350 TCACACCTCTGCTCTCAGGAAGG + Intergenic
1176158337 20:63634869-63634891 TCATACCTCTAATCCCAGCAAGG - Intergenic
1176515535 21:7780780-7780802 CCACTCCCCTGCCCCCAGCAGGG + Intergenic
1177694250 21:24551962-24551984 TCACACCTGTAATCCCAGCATGG - Intergenic
1178394952 21:32235002-32235024 CCTCTCCTCTCCTCCCAGCATGG + Intergenic
1178649563 21:34410792-34410814 CCACTCCCCTGCCCCCAGCAGGG + Intergenic
1178771016 21:35504144-35504166 CCACTCCTCCTCTCTCACCAAGG - Intronic
1179417213 21:41208444-41208466 TCTCTCCTCTCTTCCCAGCCCGG - Intronic
1179891407 21:44337199-44337221 ACACTCAAGTTCTCCCAGCAGGG + Intronic
1180970998 22:19815542-19815564 TCAGTCCTCCACTCCCCGCAGGG - Intronic
1181895230 22:26101372-26101394 TTCCTGCTCTTCTCCCAGAAAGG + Intergenic
1184171984 22:42765267-42765289 TCCCTGCTCTTCTCCCAGGCCGG - Intergenic
1184429927 22:44436656-44436678 TCACGCCTGTAATCCCAGCACGG - Intergenic
1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG + Intronic
1184846747 22:47092414-47092436 TCATTCCTGCTCTCCCAGCCTGG - Intronic
1184924146 22:47625753-47625775 TGACCCCTCTTCTGCCAGCCTGG + Intergenic
1185276896 22:49953764-49953786 GCACTCCTGTTCCCCCAACATGG + Intergenic
950718434 3:14865834-14865856 CCACTCCTCCTCTCCCAAGAAGG + Intronic
950887635 3:16375105-16375127 TTACTCCTCTTCTGCCAGGTGGG - Intronic
950950209 3:16991031-16991053 TCCCTCCTCCTCTCTCTGCAGGG - Intronic
952156446 3:30648652-30648674 TCACTCTTCCTGTCACAGCAGGG + Intronic
952698975 3:36304971-36304993 TCACACCTATAATCCCAGCAAGG + Intergenic
953892218 3:46759980-46760002 TCACTCCTCCTCTTCCAGGAAGG - Intronic
956240555 3:67125497-67125519 TCACTCCTCTAATCCCAGCGTGG - Intergenic
956527179 3:70178115-70178137 TCACCCCCCTTCCCCCAGGAGGG + Intergenic
956796776 3:72724958-72724980 TCACGCCTGTAATCCCAGCATGG + Intergenic
958909862 3:99981873-99981895 TCACACCTGTAATCCCAGCAAGG + Intronic
959594405 3:108114049-108114071 TCAGTCCCCTGCTCCCAGCAAGG + Intergenic
959837175 3:110932922-110932944 TCATTCCTCATTCCCCAGCAGGG + Intergenic
960551853 3:118984778-118984800 TCCCTCCTCTTGTCTCAGCGTGG - Intronic
960799078 3:121519880-121519902 CCACTCCTTTCCTGCCAGCACGG + Exonic
961366752 3:126404930-126404952 TCACGCCTGTAATCCCAGCAGGG - Intronic
961497421 3:127304678-127304700 GCACTGCTCTCCTCCCACCATGG + Intergenic
962403337 3:135079962-135079984 TCACACCTCTTCGTCCAGCCAGG - Intronic
962846916 3:139281234-139281256 TCTCTCCTCTCCTTCCAGTATGG + Intronic
962955974 3:140267193-140267215 TCCCTCCTCTTAACCCACCAAGG + Intronic
963102815 3:141622614-141622636 ACACTCCTCTTCTCTCCGCCAGG - Intergenic
964884790 3:161469343-161469365 TCAATCCTCTCCTTCCAGGAAGG - Intergenic
965422695 3:168481570-168481592 TCATTCCTCTTAACCCAGCAAGG - Intergenic
966334750 3:178855600-178855622 TCTCTCATCTTCTCATAGCAGGG - Intergenic
966723463 3:183087610-183087632 TCACGCCTGTAATCCCAGCAAGG + Intronic
967242062 3:187449266-187449288 CAAGTCCTCTTCTCCCAGCCAGG - Intergenic
967748370 3:193085167-193085189 TCCCTCCTTTTGTCCCAGCAGGG + Intergenic
969479580 4:7440846-7440868 TCACCCCGCAGCTCCCAGCAGGG - Intronic
969705960 4:8791785-8791807 TCCCTTCTCTTCTCACAGCCAGG + Intergenic
969710567 4:8840801-8840823 GGACCCCTCTTATCCCAGCAGGG + Intergenic
970044638 4:11838024-11838046 CCACTCCTCTCTTCCCACCATGG + Intergenic
971824241 4:31599946-31599968 TACCTCCTCCACTCCCAGCAGGG - Intergenic
972746346 4:41935785-41935807 TCTTTCCTCTTCTCCCACCTCGG + Intronic
976194581 4:82520628-82520650 TCACGCCTGTTATACCAGCACGG + Intronic
979139160 4:117150883-117150905 TGACTCCACTTCTCACAGCCAGG + Intergenic
979267123 4:118716560-118716582 TCACTCATTTTCCCCAAGCATGG + Intergenic
979770297 4:124515957-124515979 TCACTCCTTTTCTCCCAAGAGGG + Intergenic
981938865 4:150260783-150260805 TCACGCCTGTAATCCCAGCAAGG + Intergenic
982291069 4:153783245-153783267 TCAGTCCATTTCTCCCACCATGG - Intronic
985801121 5:2005776-2005798 ACACCCGTCTTCTCCCAGGATGG - Intergenic
986174260 5:5338586-5338608 TCACACCTGTAATCCCAGCATGG - Intergenic
986819198 5:11446751-11446773 TAACTCATCTTCTCTCTGCAGGG - Intronic
986989500 5:13535227-13535249 GCACCCCTCTTCTCCCTGCAGGG + Intergenic
987285296 5:16449976-16449998 TCACTCCACTGCACCCAGCCTGG + Intergenic
988430959 5:31118051-31118073 TCCCTCCCCTTCTCCCACCCAGG + Intergenic
989802895 5:45565757-45565779 TCACACCACTGCACCCAGCAAGG + Intronic
990078702 5:51885446-51885468 TCACGCCTGTAATCCCAGCACGG + Intergenic
990302271 5:54460646-54460668 TCATTCTTCTGCTCCCAGCTTGG - Intergenic
991633562 5:68680770-68680792 CCACTCCACTCCTCCCAGCCTGG - Intergenic
994189524 5:96853591-96853613 GAACTCATCTTCTCCCAGGAAGG + Intronic
994947181 5:106410080-106410102 TCACGCCTGTAATCCCAGCACGG - Intergenic
995042463 5:107604811-107604833 TCACTCATCTATTCCCATCACGG + Intronic
995068339 5:107888519-107888541 TCACTTCTATTCTCCCAACAAGG + Intronic
995266728 5:110171025-110171047 TCATTGCTATTCTCCCAGCCTGG - Intergenic
997431099 5:133841796-133841818 TCACTTGTCTTCTCCTCGCAGGG + Intergenic
997654779 5:135546650-135546672 TCTGTCCTCATCTCCCAGCATGG - Intergenic
997672726 5:135689684-135689706 TCTCTCCTCTTTTACCAACAAGG - Intergenic
997925078 5:138023067-138023089 TCACACCTGTAATCCCAGCAAGG - Intronic
997926457 5:138034781-138034803 TTGCTCCTGTTCTCCAAGCATGG - Intronic
998231562 5:140364242-140364264 TCTCTCCTATTCACCCAGCCAGG - Intronic
998393817 5:141805531-141805553 TAAATCCTCTTCCCCCATCAGGG - Intergenic
999195398 5:149778335-149778357 ACAGACCTCTTCTCCCATCACGG - Intronic
999500033 5:152137617-152137639 GCAGTCCACTTCTCCTAGCAAGG - Intergenic
999858524 5:155620823-155620845 ACACTGCTCTTCTCTCAGCAGGG - Intergenic
1000728784 5:164804727-164804749 TCACGCCTGTAATCCCAGCAGGG - Intergenic
1000924734 5:167179903-167179925 TCTCTCCTATTCTCCCAACTAGG - Intergenic
1001303144 5:170552589-170552611 TCACTCCCCTTCTCCCTGACTGG - Intronic
1002662462 5:180801006-180801028 TCACTTCTCATCTCCCACCATGG - Intronic
1003094806 6:3133668-3133690 TGACTTCTCTTCTCCCAGAATGG + Intronic
1003178672 6:3773079-3773101 TCATTCCTGTAATCCCAGCATGG + Intergenic
1003903076 6:10673204-10673226 TAACTCCTCTTTCCCCACCAGGG - Intronic
1005896464 6:30183368-30183390 TCACACCTGTAATCCCAGCAAGG + Intergenic
1005938856 6:30546075-30546097 GCACTCATCCTCACCCAGCAGGG + Exonic
1005944726 6:30587009-30587031 TCACTCCTATAATCCCAGCAGGG + Intronic
1006790690 6:36699151-36699173 TCAATCCTTCTCTCCCAGGAGGG - Intronic
1006879227 6:37324741-37324763 TTACTTCTCTTCTCACACCAGGG + Intronic
1007177246 6:39905393-39905415 TCCCTCCTCTTCTTCCCTCAGGG + Exonic
1007688455 6:43681671-43681693 GAAATCCTCTTCTCCCTGCAGGG + Intronic
1008316864 6:50054366-50054388 TCATTCCTTTATTCCCAGCAAGG - Intergenic
1008657243 6:53628425-53628447 TCACTCCTCCACTTCCAGCAAGG + Intergenic
1009334550 6:62470604-62470626 TCCCTTCTCTTTCCCCAGCAAGG + Intergenic
1009619275 6:66051663-66051685 GCTCTCCTATTCTCCTAGCATGG + Intergenic
1010150781 6:72729530-72729552 TCACGCCTGTAATCCCAGCAAGG - Intronic
1011280195 6:85669795-85669817 TCACGCCTGTAATCCCAGCAAGG - Intergenic
1011776660 6:90738791-90738813 TCACAACTCTTCTCCCACAAGGG - Intergenic
1011821528 6:91258445-91258467 TCACACCTCTTTTCACAACAGGG + Intergenic
1012497794 6:99853670-99853692 ACACTCCTCCACTCCCAGCTTGG + Intergenic
1013413274 6:109901332-109901354 TCTCACCTCTTCTCCCAGCAAGG + Intergenic
1015279204 6:131415079-131415101 TGACTCAAATTCTCCCAGCAAGG - Intergenic
1016977619 6:149824593-149824615 TCACACCTGTAATCCCAGCATGG + Intronic
1017919294 6:158857480-158857502 CCCCTCCCCTTCTCTCAGCATGG + Intergenic
1019783010 7:2955481-2955503 TTGCACCTCTGCTCCCAGCAGGG + Intronic
1020255109 7:6498455-6498477 TCACCCCTGTTCTCTCTGCAGGG + Intronic
1021581168 7:22155172-22155194 TGACTCCATTTCTCCCATCAAGG + Intronic
1022177335 7:27884388-27884410 CCACACCTGTTATCCCAGCACGG - Intronic
1022295063 7:29043027-29043049 TCAGTCCTCTTCTCAGAGAAAGG - Intronic
1022312726 7:29212452-29212474 TCTCTCCTCTTCTTCCTCCATGG + Intronic
1022339490 7:29455085-29455107 GCAATCCTGTTCTCCCACCATGG + Intronic
1022414278 7:30164769-30164791 TCACTTCTCTTTCCCCAGCCTGG - Intergenic
1025942780 7:66086294-66086316 TCACTCAGCATCTCCGAGCAGGG - Intronic
1025944626 7:66096290-66096312 TCACACCTGTAATCCCAGCACGG + Intronic
1026157894 7:67843202-67843224 CCAGTCCTCTCCTCCCAGTATGG - Intergenic
1027412368 7:77934685-77934707 TCACGCCTCTAATCCCAGCTTGG + Intronic
1027722736 7:81765999-81766021 TTTTTCCTCTTCTCCCAGTATGG + Intronic
1029335168 7:99892689-99892711 AAACTCGTCTTCTCCCAGGAAGG - Exonic
1030093103 7:105875230-105875252 TCATCTCTCTTTTCCCAGCATGG - Intronic
1030635909 7:111948493-111948515 TCATTCCTCTTAACCCAGGAAGG - Intronic
1032088931 7:128901121-128901143 TCACTGCTATACTCCCACCAGGG + Intronic
1032305489 7:130730076-130730098 TCCCTGTTCTTCTCCAAGCAGGG - Intergenic
1032625255 7:133584837-133584859 TCACGCCTGTAATCCCAGCACGG - Intronic
1034448438 7:151125172-151125194 GCACTCCCCATCTCCAAGCAGGG - Intronic
1034697760 7:153069174-153069196 TCTCTTCTCATCTCCCAGCTTGG - Intergenic
1035451099 7:158977432-158977454 TCAGGCCTCTGCTCCCAGCTGGG + Intergenic
1036583101 8:10095535-10095557 TCACTCTTTTGCTCCCAGTATGG - Intronic
1037320913 8:17641675-17641697 TAACAGCTCTGCTCCCAGCACGG + Intronic
1037990196 8:23316422-23316444 CTGCTCCTCTTCTCTCAGCATGG + Intronic
1038500495 8:28039738-28039760 TCCATGCACTTCTCCCAGCACGG + Intronic
1038617863 8:29112185-29112207 TCACGCCTGTAATCCCAGCACGG + Intronic
1038895256 8:31775622-31775644 TCACGCCTGTAATCCCAGCACGG + Intronic
1039031532 8:33314959-33314981 GCAATCATCTTCTCCCATCAAGG - Intergenic
1039880634 8:41623382-41623404 TCCCTCCTGTTACCCCAGCAAGG + Exonic
1048950453 8:139492423-139492445 TAACTTATCTTCTCCCTGCAGGG + Intergenic
1049086350 8:140481328-140481350 TCACGCCTGTAATCCCAGCACGG + Intergenic
1049105500 8:140609928-140609950 TCACACCTATAATCCCAGCACGG + Intronic
1049220658 8:141427377-141427399 TTCCTCCCGTTCTCCCAGCAGGG - Intronic
1049287735 8:141785596-141785618 TCTCTCCTCATGTGCCAGCACGG - Intergenic
1050301650 9:4264901-4264923 TCACGCCTGTAATCCCAGCACGG + Intronic
1053236856 9:36462933-36462955 TCACACCTGTAATCCCAGCAGGG - Intronic
1055517396 9:77047144-77047166 TCACTCCTCCTCTTCCTTCAGGG - Intergenic
1056194093 9:84212745-84212767 TCACACCTGTTATCCCAGCACGG + Intergenic
1056257401 9:84814077-84814099 TCTCTCCCAGTCTCCCAGCAGGG + Intronic
1056309958 9:85330590-85330612 CTGCTCCTCTTCTCCCACCAAGG - Intergenic
1057209819 9:93193659-93193681 TCAGTCCTCTCCACCCAGCTGGG - Intronic
1058120016 9:101127843-101127865 ACACTCATCTTTTCCCAGGAAGG + Intronic
1058175245 9:101728351-101728373 TCACTCCTCTCCTCACCGCCAGG - Intronic
1058643006 9:107105369-107105391 TCCCTCCTTTTCTCCTTGCAGGG - Intergenic
1059422028 9:114198078-114198100 TCACTTCCCTTCTCCCCTCAAGG - Intronic
1060011225 9:120044392-120044414 TCACTGCTGTCCTCCCAGCATGG - Intergenic
1060244858 9:121936482-121936504 TCACTCCTTTTCTGCCCTCAAGG + Intronic
1060305102 9:122404515-122404537 TCACTACTCTTCTACTAGCAAGG - Intergenic
1060943690 9:127557724-127557746 TCACTCCTCTGCTCCAAGAGGGG + Intronic
1187586471 X:20668076-20668098 TCATTCCTCCTCTCCAATCATGG - Intergenic
1187886204 X:23891182-23891204 TCTCTCCTCTTCTCACTCCAGGG + Intronic
1189433558 X:40970903-40970925 TCACGCCTGTAATCCCAGCAGGG - Intergenic
1189986298 X:46556406-46556428 TCACTCCTTTTTTCCATGCAGGG + Intergenic
1192840171 X:74846895-74846917 TCCATCCCCTTCACCCAGCATGG - Intronic
1194784662 X:98067394-98067416 TCAGTCCTCTTCTCCTTTCATGG + Intergenic
1195738135 X:108034209-108034231 TCCATCCTCCTCTCCCAGCCAGG - Intergenic
1196757713 X:119172411-119172433 TCACCCCTCTACTCCCAGAGGGG - Intergenic
1199637883 X:149830425-149830447 CCTCTGCTCTCCTCCCAGCAAGG - Intergenic
1199763356 X:150922629-150922651 TCACGCCTGTAATCCCAGCACGG - Intergenic
1200835365 Y:7726818-7726840 TTACTCCTCTTCTGCCAGGTGGG - Intergenic
1201571796 Y:15423111-15423133 TCACTCCTACTTTCCCAGCATGG + Intergenic