ID: 1067082782

View in Genome Browser
Species Human (GRCh38)
Location 10:43221085-43221107
Sequence ATCACTCCTCTTCTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082782_1067082784 -5 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082784 10:43221103-43221125 GTGATCCCATCCCTCCACCCGGG No data
1067082782_1067082797 28 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082782_1067082786 -3 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082786 10:43221105-43221127 GATCCCATCCCTCCACCCGGGGG No data
1067082782_1067082785 -4 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082785 10:43221104-43221126 TGATCCCATCCCTCCACCCGGGG No data
1067082782_1067082795 21 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082795 10:43221129-43221151 CTGCGGTCCCTCTGCTCTGAAGG No data
1067082782_1067082783 -6 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082783 10:43221102-43221124 AGTGATCCCATCCCTCCACCCGG No data
1067082782_1067082789 4 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082789 10:43221112-43221134 TCCCTCCACCCGGGGGTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082782 Original CRISPR ATCACTCCTCTTCTCCCAGC AGG (reversed) Intronic
900192252 1:1356491-1356513 ATGACTCCTCTTCCCCTACCAGG - Intronic
901308386 1:8250222-8250244 AGAATTCCTTTTCTCCCAGCTGG + Intergenic
901374562 1:8828448-8828470 CTCACTCCTGTTGTCCAAGCTGG - Intergenic
903285195 1:22272702-22272724 CTCACTCCTTTCCTCCCACCTGG + Intergenic
905280425 1:36845770-36845792 AGGAGTCCTATTCTCCCAGCAGG + Intronic
905453068 1:38069390-38069412 ACCACTGCACTTCTCCCCGCTGG - Intergenic
906749542 1:48246814-48246836 ATCACTCAGCTTCTCTGAGCTGG - Intronic
907318980 1:53590954-53590976 AACACTCCCATTCTCGCAGCTGG - Intronic
909120416 1:71596284-71596306 CTCGCTCCTCTTCTCCCTTCTGG + Intronic
912316897 1:108675493-108675515 GACACTCCTCATCTCCCAGACGG - Intergenic
912458950 1:109818575-109818597 AGAACTCCTCTTTTCCCAGAGGG + Intergenic
915920578 1:159972918-159972940 ACAACTCCTCTCCTCCCAGGGGG + Intergenic
916117768 1:161502234-161502256 CTCCCTCCTCTGCTCCCAGGGGG - Intergenic
920396367 1:205648874-205648896 CTCCCTCCTCCTCTCCCATCAGG + Intergenic
922157598 1:223052283-223052305 CTCCCTCCTCTTCTCCCTCCTGG + Intergenic
922531898 1:226351198-226351220 CTCACTCCTGTAATCCCAGCAGG - Intergenic
922564585 1:226593413-226593435 CTCACCCTTCTCCTCCCAGCAGG + Intronic
922986647 1:229871246-229871268 CTCTATCCTCTTCTCCCAGGAGG - Intergenic
1064396312 10:14984668-14984690 GTCACTCCTCTTATCACAGAGGG + Intronic
1066116503 10:32245093-32245115 ATCATTCCTCATCTTTCAGCAGG + Intergenic
1067082782 10:43221085-43221107 ATCACTCCTCTTCTCCCAGCAGG - Intronic
1067334153 10:45347442-45347464 AGCACTCCTCACCTCCCAGACGG - Intergenic
1068651504 10:59527945-59527967 ATCCTTCCTCTTCTGCTAGCTGG + Intergenic
1069548443 10:69345525-69345547 CTCCTTCCTCTTCTCTCAGCTGG - Intronic
1069847011 10:71379223-71379245 ATTCCTCCTCTTCTCAGAGCAGG + Intergenic
1070194690 10:74146436-74146458 ATCACCACTCATCTCCCAACTGG - Intronic
1071524313 10:86349287-86349309 TTCTCTTCTCTTCTCCCACCTGG - Intronic
1071938808 10:90563465-90563487 CTCATTCCTCTTCTCCTATCTGG + Intergenic
1072446202 10:95500925-95500947 ACCACGCATCTTCTCCCAGCTGG + Intronic
1072849958 10:98879450-98879472 AACACTACTCTTGTTCCAGCTGG + Intronic
1073583693 10:104689131-104689153 ATCACTCCTGTCCTCCCACCTGG + Intronic
1073701816 10:105935571-105935593 TTCACTCTTCTTGCCCCAGCTGG + Intergenic
1074108241 10:110404490-110404512 CTTACTCTTCTTCCCCCAGCAGG - Intergenic
1074522917 10:114240872-114240894 AGCAATCCTCTTCTCCAACCTGG - Intronic
1074790904 10:116887007-116887029 ATTACTCCCCTTGTCCCTGCAGG - Intronic
1075598598 10:123750338-123750360 TGCACTCCACTGCTCCCAGCCGG + Intronic
1076512783 10:131024286-131024308 CTCTCTCCCCTTCTCTCAGCTGG - Intergenic
1076812830 10:132898204-132898226 ATGCCTCCCCATCTCCCAGCAGG + Intronic
1077364367 11:2155580-2155602 CTCACTCCTCTGCTCCCAGGTGG - Intronic
1078315509 11:10290164-10290186 ACAACTGCTCTTCTCACAGCAGG - Intronic
1078679457 11:13462671-13462693 CTCACTCCTCTTCACCCAGAGGG + Intronic
1078795073 11:14584168-14584190 ATGTCTCCATTTCTCCCAGCTGG - Intronic
1079040831 11:17058050-17058072 ATTACTCCTATTGTCACAGCGGG - Intergenic
1079103999 11:17558938-17558960 ATCTCTCCTCTCCACCCAGCTGG - Intronic
1079248792 11:18772571-18772593 ATCCCTCCTCTTCTCTGAGTGGG + Intronic
1083999770 11:66289690-66289712 CCCACTCCTCTTCTCCGCGCGGG + Intergenic
1085170426 11:74445143-74445165 CTAACTGCTCTTCTCCCAGCAGG - Intergenic
1088315216 11:108499411-108499433 CGCACTCCTCTTCTTCCAGCAGG + Intergenic
1088361286 11:108992691-108992713 CTCACTCCTTTTCTCCAGGCTGG - Intergenic
1088741837 11:112773893-112773915 TGCTCTCCTCTTCTCCCAGCAGG + Intergenic
1088750590 11:112839091-112839113 ACCACTCTGCTTTTCCCAGCAGG - Intergenic
1089162955 11:116453512-116453534 ATCTCTCCTCTACTCCAAGCTGG - Intergenic
1090084828 11:123641737-123641759 ACCTGTCCCCTTCTCCCAGCAGG + Intronic
1090726223 11:129529692-129529714 ATCACTCCCCTTTTCCAGGCAGG - Intergenic
1091596756 12:1883593-1883615 AGCACCTCTCTGCTCCCAGCAGG + Intronic
1093065584 12:14654779-14654801 GTCTCTCATCTTCTCCCAGATGG - Intronic
1093628934 12:21385668-21385690 ATCACTTTTCTTCACACAGCTGG + Intronic
1094222474 12:28009157-28009179 ATCACTCCTGTACACCCAGATGG + Intergenic
1094498915 12:31006316-31006338 ATCAGTGCCCTTCTCCAAGCAGG + Intergenic
1095965476 12:47864397-47864419 ATCACTCCTCTTTCTCCATCTGG + Intronic
1096805950 12:54141214-54141236 ATCACTGCTTTCCTCCCCGCCGG + Intergenic
1099479930 12:83152787-83152809 GTCACTTCTCTTCACCCAGAGGG - Intergenic
1101860484 12:108478504-108478526 ATCACTCCTCTAACCCCAGCTGG + Intergenic
1102814920 12:115858070-115858092 CTCACTCCTCCTCCACCAGCTGG + Intergenic
1103487974 12:121296052-121296074 ACCGCACCTCTTCTCTCAGCCGG - Intronic
1103864870 12:124043665-124043687 TTCATTTCTCTTCTCACAGCAGG - Intronic
1103895536 12:124270738-124270760 TACACTCATCTTCTCCCTGCCGG - Intronic
1105035705 12:132919301-132919323 AGCTCTCCTCTCCTCCCAGCTGG + Intronic
1107545523 13:41430250-41430272 ATGACTCGTCATATCCCAGCGGG + Intergenic
1109361478 13:61299570-61299592 ATCATTCCTCCTCACCCAGCAGG + Intergenic
1109840570 13:67912938-67912960 ATGACTCGTCATATCCCAGCAGG - Intergenic
1110446949 13:75595565-75595587 ATCACTCCTGTTGCCCCGGCTGG - Intronic
1112339714 13:98543097-98543119 ATGACTGGTCTCCTCCCAGCCGG - Intronic
1114162797 14:20187849-20187871 TTCACACCTACTCTCCCAGCTGG + Intergenic
1115985849 14:39103115-39103137 ATCTGTCCTCTCCGCCCAGCAGG + Exonic
1118761545 14:68883141-68883163 ATGCCTCCTGGTCTCCCAGCTGG - Intronic
1120479100 14:85026131-85026153 ATCACTCCTCTTTTCTCATTCGG - Intergenic
1121282085 14:92706283-92706305 AACACTCTTCTTGTCCCAGTGGG - Intronic
1122140024 14:99657493-99657515 ATCCCTTCCCTTCTTCCAGCAGG - Intronic
1122524920 14:102374910-102374932 CTCACCCCTCTTCCCCCCGCAGG - Intronic
1202848421 14_GL000225v1_random:990-1012 ATCACTCCTGGTCTCCAGGCTGG - Intergenic
1124215763 15:27806177-27806199 GTCAGCCCTCTGCTCCCAGCTGG - Intronic
1126354083 15:47776257-47776279 CTTTCTCATCTTCTCCCAGCTGG + Intergenic
1128243646 15:66118376-66118398 CACACTGCTCTTCTCCCAGAGGG + Intronic
1128631444 15:69272526-69272548 CTCCCTCCTCTTCTTCCACCTGG - Intergenic
1128755478 15:70180870-70180892 CTCACTTCTCTTCTCCCCACTGG - Intergenic
1128830486 15:70763677-70763699 AACACCCTTCCTCTCCCAGCTGG + Intergenic
1128901461 15:71426177-71426199 TTGACACCTCTTCCCCCAGCTGG + Intronic
1129860863 15:78860250-78860272 CTCACTCCTATTCTCCGGGCTGG + Intronic
1130853008 15:87816536-87816558 AGCACTCCACATCACCCAGCAGG + Intergenic
1132482418 16:173103-173125 CTCACTCTGCTTCTCCCCGCAGG + Exonic
1132483266 16:176907-176929 CTCACTCTGCTTCTCCCCGCAGG + Exonic
1132503726 16:296593-296615 AGCACTTCTCTCCTCCCAGAAGG - Intronic
1132736582 16:1389002-1389024 AGAACTCCTCATCTTCCAGCCGG + Intronic
1132926237 16:2430385-2430407 CTCTCTCCTCTTCCCACAGCCGG - Intronic
1132976201 16:2712334-2712356 AGCACTCCGCATCTCCCACCTGG + Intergenic
1133416255 16:5609431-5609453 ACCTCTCCTCTGCCCCCAGCAGG - Intergenic
1133991174 16:10708711-10708733 ATTACTCCTCATATCTCAGCTGG - Intergenic
1135591901 16:23711098-23711120 ATGACTCCCCTTCCCCCAGATGG + Intronic
1136009493 16:27353971-27353993 ATCACGCCTCTTCTGCTGGCTGG - Intronic
1136130731 16:28219282-28219304 ATTCCTCCTCTTGTCCCTGCAGG - Intergenic
1136895925 16:33995970-33995992 CTCACTCCTCTGCCCCCAGCCGG + Intergenic
1138199916 16:55080930-55080952 TTCACACTTCTTCTGCCAGCTGG + Intergenic
1139480520 16:67227990-67228012 ACCACTCCTCGTCACCAAGCAGG - Intronic
1140086492 16:71801659-71801681 GTCACGCCTGTTATCCCAGCAGG + Intronic
1140991515 16:80217309-80217331 TTCACTCATCTTCTCCCTCCAGG + Intergenic
1141109474 16:81260536-81260558 TTCACTCTTCTTGTCCAAGCTGG + Intronic
1142045730 16:87924146-87924168 TTCCCTCTTCTTCTCCGAGCTGG + Intronic
1142796878 17:2314721-2314743 TTCACTCCTGTTGTCCCGGCTGG - Intronic
1142887506 17:2921887-2921909 CTCCCTCCTCTTCTCCCTGGGGG + Intronic
1142990127 17:3724580-3724602 ATCTCTCCCCTGCTCCCAGGAGG + Exonic
1144222808 17:13115096-13115118 ATCATTCCTCTTCTCTGAGGTGG - Intergenic
1144694658 17:17294456-17294478 CTCACACCTGTTATCCCAGCAGG - Intergenic
1145174849 17:20690580-20690602 ATGACTCCTCTTTTCCAATCCGG + Intergenic
1145902184 17:28496303-28496325 AGCCCACCTCTTCTCCCAGAAGG - Intronic
1145933627 17:28702698-28702720 ATCTCTTCCCTTTTCCCAGCTGG + Intergenic
1146411173 17:32586913-32586935 AGCAGTCCTCTTTTCCTAGCTGG + Intronic
1147303791 17:39549636-39549658 ATCACTGCTCTTCCCCAAACTGG - Intronic
1147604675 17:41767762-41767784 AGCACCTCTCTTCTCCCAACTGG + Intronic
1147861227 17:43524824-43524846 ATAACACCTCTCCTCTCAGCTGG + Exonic
1148194509 17:45703627-45703649 CTCCCTGCTCTGCTCCCAGCAGG + Intergenic
1148254844 17:46121221-46121243 GTCACTCCTCTACTCAAAGCAGG + Intronic
1148391819 17:47278321-47278343 CTCACTCCTGTAATCCCAGCAGG + Intronic
1149593893 17:57851986-57852008 CACACTTCTCTTCTCCCACCAGG + Intergenic
1150200328 17:63349515-63349537 ATCAGCCCTCCTCTCCCAGGTGG - Intronic
1151347100 17:73508807-73508829 ATCTGTCCTCTCCTCCCACCCGG - Intronic
1151672288 17:75577779-75577801 CTCACTCATCTCCTCCCATCTGG - Intergenic
1152009140 17:77700220-77700242 ACCCCTGCTCTTCTCCCAGGAGG - Intergenic
1152273472 17:79339665-79339687 AGCACAGCTCTTCTCTCAGCAGG - Intronic
1152793906 17:82297487-82297509 CTGACTCATCTTCTCCCACCAGG - Intergenic
1152863901 17:82710951-82710973 CTGACTCCACTCCTCCCAGCCGG + Intergenic
1153748891 18:8209487-8209509 ATTTCTCCTCATCTCCCACCCGG - Intronic
1153756949 18:8293986-8294008 CTCACTCCTGTAATCCCAGCAGG + Intronic
1155072745 18:22330559-22330581 ATCATTCCTGTCCCCCCAGCAGG + Intergenic
1156545728 18:37961857-37961879 TTCACTCCTCATCTCCAAGATGG - Intergenic
1156656468 18:39294395-39294417 ATCACTGCTCTACTCCCTGAAGG - Intergenic
1157393802 18:47325543-47325565 ATGAGTCCCCTTCTCCCAGTTGG + Intergenic
1160094506 18:75859641-75859663 AGCAATCCTCCCCTCCCAGCTGG + Intergenic
1160251434 18:77206929-77206951 TCGACTCCACTTCTCCCAGCAGG - Intergenic
1160886818 19:1354004-1354026 CTCACTCCTGTAATCCCAGCAGG - Intergenic
1161274643 19:3409075-3409097 ATCACTCCTCTTCCCACTGCAGG + Intronic
1162808648 19:13151677-13151699 AACTCTCCTCTTCCCCCACCCGG + Intronic
1162852522 19:13441767-13441789 ATGACTCCTCTCCTCTCACCAGG - Intronic
1163106347 19:15125128-15125150 ATCGCGCCCCTTCTCGCAGCAGG + Intronic
1163588199 19:18175346-18175368 TGCACTCCTCTTCTCCATGCTGG - Exonic
1165866508 19:38942751-38942773 CTCACTCCCCTTCCCCCTGCAGG - Exonic
1167018826 19:46859946-46859968 ATCACTACTCTTTTCCCTTCAGG + Intergenic
1167112558 19:47470871-47470893 CTCTCTCCACTCCTCCCAGCCGG - Intronic
1167641934 19:50687015-50687037 ACCACTCTTCTTCTTCCAGGGGG + Intronic
1167930987 19:52864619-52864641 AAAACTCCTCTTCTCCCAGGAGG + Intronic
925187746 2:1860789-1860811 ATGACTCCTCATCCCACAGCGGG - Intronic
926651764 2:15354287-15354309 ATCACCCCCCAACTCCCAGCAGG + Intronic
927146794 2:20171569-20171591 GTTTCTCCTCTTCTCCCATCAGG - Intergenic
927247695 2:20971056-20971078 CTCCCTTCTCTTCTCCCAGTGGG + Intergenic
927812842 2:26189732-26189754 ATCAGTCCTCTCCTGCCAGAAGG - Intergenic
927917869 2:26948187-26948209 CCCACTCCTCCTCTCTCAGCAGG - Exonic
932351924 2:71039654-71039676 ATGACTCATCATATCCCAGCGGG - Intergenic
932580142 2:72988125-72988147 ATTACACCAATTCTCCCAGCTGG + Intronic
933341385 2:81030282-81030304 ATTTCTCTTCTCCTCCCAGCGGG + Intergenic
937986834 2:127641798-127641820 ACCTCTCCTCTTCCCCCTGCTGG - Intronic
938605715 2:132890710-132890732 ATCACTCATCTTATCACACCTGG + Intronic
938843052 2:135181374-135181396 ATGTCTCCTCTTCTCCCAGTAGG + Intronic
939023969 2:136989770-136989792 ATCTCTACCCCTCTCCCAGCTGG - Intronic
940316916 2:152335868-152335890 AGCACTCCTCTTCACCCCCCTGG + Intronic
940869992 2:158851446-158851468 ATCACTCCTGTTATCACAGTGGG - Intronic
942522510 2:176819236-176819258 AGGACCCCACTTCTCCCAGCAGG - Intergenic
944320213 2:198331844-198331866 ATCACTCTTCTGCCTCCAGCTGG + Intronic
946757255 2:222960052-222960074 CTCAGTCCTCTTTTCCCAGGTGG + Intergenic
948029097 2:234801652-234801674 TTCACTCCTCTGGGCCCAGCAGG - Intergenic
948331044 2:237165657-237165679 ATCACTCCTGTCTCCCCAGCTGG + Intergenic
948423232 2:237873198-237873220 ATCACTGTCCTCCTCCCAGCTGG - Intronic
948681040 2:239634856-239634878 ATCACTCCCCACCTCCCTGCTGG - Intergenic
1169158841 20:3358548-3358570 CTCACGCCTGTTATCCCAGCAGG - Intronic
1169236471 20:3933842-3933864 TCCACTCCTCTTCTCTCGGCAGG + Exonic
1169275909 20:4233704-4233726 ATCACTCTTCTGCCCCCTGCTGG + Intronic
1169326591 20:4681729-4681751 CCCACTCCTCTGCTCCCCGCAGG + Intergenic
1169954292 20:11084190-11084212 CTGACACCTCTTCTCTCAGCAGG - Intergenic
1170503411 20:16998591-16998613 ATTTCTCCTTTCCTCCCAGCAGG - Intergenic
1172614179 20:36272779-36272801 ATCTCTCCTCCGTTCCCAGCAGG - Intergenic
1172952938 20:38733618-38733640 ATCTCTCCTCATCTCCCTGAGGG + Intergenic
1173006455 20:39143111-39143133 CTCCCTCCTCTTCTCCCCGTTGG + Intergenic
1173266067 20:41483352-41483374 AGTACTCATCTTCTCCCAGATGG - Exonic
1173747072 20:45445876-45445898 TGCATTGCTCTTCTCCCAGCTGG - Intergenic
1176087277 20:63303881-63303903 CACCCTCCTCTTCTCCCTGCAGG + Intronic
1176087287 20:63303921-63303943 CTCCCTCCTCTTCTCCCTGCAGG + Intronic
1176087297 20:63303961-63303983 CTCCCTCCTCTTCTCCCTGCAGG + Intronic
1176087331 20:63304081-63304103 CTCCCTCCTCTTCTCCCTCCAGG + Intronic
1176087342 20:63304121-63304143 CTCCCTCCTCTTCTCCCTCCAGG + Intronic
1176087403 20:63304321-63304343 CTCCCTCCTCTTCTCCCTGCAGG + Intronic
1176087452 20:63304481-63304503 CTCCCTCCTCTTCTCCCTGCAGG + Intronic
1176087510 20:63304681-63304703 CTCCCTCCTCTTCTCCCTGCAGG + Intronic
1178621339 21:34179371-34179393 ACCACCCACCTTCTCCCAGCTGG - Intergenic
1182527764 22:30932192-30932214 AACTCTCCTCTTCTTTCAGCAGG + Intronic
1183874800 22:40770765-40770787 ATCACTTCTCTTCACTCAGGAGG + Exonic
1184105188 22:42363350-42363372 AGCACTACTGTTCTCCCAACAGG + Intergenic
950887636 3:16375106-16375128 TTTACTCCTCTTCTGCCAGGTGG - Intronic
953675992 3:45002964-45002986 ATGACTCCCCATCTGCCAGCTGG + Intronic
954831379 3:53424320-53424342 ATCACTCCTCAACTCCTGGCAGG + Intergenic
955070081 3:55565406-55565428 CTCTCTCCTCTCTTCCCAGCAGG - Intronic
956527178 3:70178114-70178136 ATCACCCCCCTTCCCCCAGGAGG + Intergenic
956756237 3:72390161-72390183 ATCACTCTTCTCCTGCCAGATGG + Intronic
960265302 3:115614498-115614520 CCCACTCCCCTTCTCCCAACGGG - Intergenic
961274187 3:125714061-125714083 ATGACTCATCATATCCCAGCGGG - Intergenic
962804280 3:138915856-138915878 CTTACGCCTCTTCTCCCCGCGGG + Intergenic
963804971 3:149714062-149714084 CGCACTGCTCTTCTGCCAGCAGG - Intronic
963962067 3:151320806-151320828 ATCACTAGTCTTGTCACAGCCGG - Intronic
964412758 3:156415977-156415999 AGCACCCCTCTTCACCCAGCTGG + Intronic
965855207 3:173079912-173079934 ATTACAGCTCTTATCCCAGCAGG - Intronic
967234143 3:187367948-187367970 CTCCCTCCACATCTCCCAGCAGG + Intergenic
967748369 3:193085166-193085188 TTCCCTCCTTTTGTCCCAGCAGG + Intergenic
967835669 3:193960439-193960461 CTGACTCTTCTTCTACCAGCTGG - Intergenic
968491779 4:894009-894031 ATCACCCCTGCTCTCCCCGCAGG - Exonic
968491799 4:894069-894091 ATCACCCCTGCTCTCCCCGCAGG - Intronic
968864730 4:3200936-3200958 ATCACTCCTTTTCTGACAGATGG + Intronic
969825715 4:9756792-9756814 ATGACTCGTCATATCCCAGCGGG - Intergenic
971706674 4:30052762-30052784 ATCTCTCATTTTCTCACAGCTGG - Intergenic
972722606 4:41715493-41715515 ATCACCCATTTTCTCCAAGCTGG + Intergenic
974982877 4:68982198-68982220 AGCATTCCTCTTTTGCCAGCTGG + Intergenic
976502799 4:85811909-85811931 CTCACGCCTCTAATCCCAGCAGG + Intronic
978388299 4:108198709-108198731 ATCACTTCCCTTCTCTCAGGTGG + Intergenic
978903811 4:113983395-113983417 ATAAATGCTCTTCTCCCATCAGG - Intergenic
979770296 4:124515956-124515978 ATCACTCCTTTTCTCCCAAGAGG + Intergenic
979844347 4:125489882-125489904 CTCCTTCTTCTTCTCCCAGCAGG + Exonic
982044088 4:151424390-151424412 AGCCCTCCTCTTCTCCCCTCGGG - Intronic
982326955 4:154137774-154137796 ATCATTTCTCTTCACCCTGCGGG + Intergenic
982613858 4:157615088-157615110 ATCCCTCCTTTTCTCCCAGAGGG + Intergenic
983931290 4:173455619-173455641 TTCACTCCACTTCTCCCTGAAGG - Intergenic
984390551 4:179126196-179126218 AGCACTCCCCTTCCCCCAGGTGG + Intergenic
986989499 5:13535226-13535248 GGCACCCCTCTTCTCCCTGCAGG + Intergenic
988532620 5:32040062-32040084 AGCGCTCCTCATCTCCCAGATGG - Intronic
988532648 5:32040176-32040198 AGCGCTCCTCATCTCCCAGATGG - Intronic
988673259 5:33405122-33405144 CTCACTCCTCATCCCCCACCAGG - Intergenic
992014422 5:72561070-72561092 CTCACTCCTCTAATCCCAGCAGG - Intergenic
992800292 5:80289557-80289579 AGCCCTCCTCATCTTCCAGCAGG - Intergenic
993270137 5:85786346-85786368 ATCCCTCCCCTTGTCCCAACAGG + Intergenic
994281340 5:97906760-97906782 GTCACTCCTGTTCTTACAGCAGG - Intergenic
994330508 5:98499980-98500002 AACCCTCCTATTCTCCCAGAAGG + Intergenic
994391036 5:99193369-99193391 ATTACTCCTCATATCCCAGTGGG - Intergenic
997025440 5:130055048-130055070 ATCACTACTCTTCACCCTGTGGG + Intronic
997431098 5:133841795-133841817 ATCACTTGTCTTCTCCTCGCAGG + Intergenic
999123094 5:149225113-149225135 CCCACTCCTCTCCTCCCAGCAGG - Intronic
999858525 5:155620824-155620846 CACACTGCTCTTCTCTCAGCAGG - Intergenic
1001085675 5:168698695-168698717 ACCACTCCCCTTCACCCACCAGG + Intronic
1005419124 6:25630991-25631013 CTCACTCCACCTCTCCCAGTGGG - Intergenic
1005938855 6:30546074-30546096 AGCACTCATCCTCACCCAGCAGG + Exonic
1005944725 6:30587008-30587030 CTCACTCCTATAATCCCAGCAGG + Intronic
1006804117 6:36777441-36777463 ATCCCTCTCCTCCTCCCAGCCGG + Intronic
1007797011 6:44357410-44357432 TTCGCTCCTGTTGTCCCAGCTGG + Intronic
1008214892 6:48777271-48777293 ATCACCCCTCTTCTCCAACAAGG + Intergenic
1011422887 6:87193020-87193042 TTCATTCCTGTTGTCCCAGCTGG + Intronic
1011776661 6:90738792-90738814 ATCACAACTCTTCTCCCACAAGG - Intergenic
1012054887 6:94393808-94393830 AGCAGTCCCCTTCTCCCATCAGG + Intergenic
1013381832 6:109580651-109580673 ACTACACCTCTTCTCCCAGCAGG + Intronic
1016872620 6:148833741-148833763 ATCACTCTGCTTCTCTGAGCTGG - Intronic
1017812518 6:157994301-157994323 ATCACTCATCTCTGCCCAGCTGG - Intronic
1019409928 7:901930-901952 ATCGCCCCTTTTCCCCCAGCAGG + Intronic
1019783009 7:2955480-2955502 ATTGCACCTCTGCTCCCAGCAGG + Intronic
1020455236 7:8365670-8365692 ATCACACATCTTCTGCCATCTGG + Intergenic
1021183683 7:17537867-17537889 ATCACGCCTGTAATCCCAGCAGG + Intergenic
1023900781 7:44476852-44476874 ATCCCTCCGCTTTCCCCAGCAGG - Intronic
1024248860 7:47491348-47491370 AGCCCTCTGCTTCTCCCAGCTGG + Intronic
1026273707 7:68858637-68858659 CTCTCTCCTTTTCTGCCAGCTGG - Intergenic
1026760422 7:73122142-73122164 CTCTCTACTCTTCTCCCAGAAGG - Intergenic
1026872412 7:73861151-73861173 GTCACCCTGCTTCTCCCAGCTGG + Exonic
1027036764 7:74930963-74930985 CTCTCTACTCTTCTCCCAGAAGG - Intergenic
1027086799 7:75270496-75270518 CTCTCTACTCTTCTCCCAGAAGG + Intergenic
1027554949 7:79652500-79652522 ATTTCTCCTTTTCTGCCAGCAGG - Intergenic
1028455298 7:91031888-91031910 ATGACTCCTTTTCTCCCAGCAGG - Intronic
1029393101 7:100288494-100288516 CTCTCTACTCTTCTCCCAGAAGG + Intergenic
1030723622 7:112898757-112898779 ATCCCTCTTCTTCCCCCAGGTGG - Intronic
1035262168 7:157669011-157669033 ACTGCTCCTCTGCTCCCAGCTGG - Intronic
1035296644 7:157871149-157871171 ATCTTTCCTCTTTTCTCAGCTGG + Intronic
1035451098 7:158977431-158977453 CTCAGGCCTCTGCTCCCAGCTGG + Intergenic
1035698614 8:1620969-1620991 CTCACTCCCCGCCTCCCAGCTGG + Intronic
1036214819 8:6870466-6870488 ATCACTCCCCTTTTCCAGGCAGG + Intergenic
1040582023 8:48705903-48705925 ATAATTCCTCTCTTCCCAGCTGG + Intergenic
1040647450 8:49415925-49415947 CTCACTCCTCATCCCCCAACAGG + Intergenic
1041033573 8:53763678-53763700 ATCACTCCAATCCTCACAGCAGG + Intronic
1041748648 8:61235872-61235894 ATTAGTCCTCATCTCCAAGCTGG + Intronic
1044449260 8:92314414-92314436 CTCAGTCCTCTTCTTCCAGTTGG - Intergenic
1045756669 8:105551687-105551709 ATCACCTCTCCACTCCCAGCTGG + Intronic
1046754256 8:117956821-117956843 CTCTCTCCTCTTCCCCCATCAGG - Intronic
1048938394 8:139375947-139375969 ATCACTCCTCATGACCCATCTGG - Intergenic
1049104154 8:140601005-140601027 AGCCATCATCTTCTCCCAGCTGG + Intronic
1051257549 9:15230715-15230737 CTCACTCCTGTAATCCCAGCAGG + Intronic
1057209820 9:93193660-93193682 CTCAGTCCTCTCCACCCAGCTGG - Intronic
1057327115 9:94075327-94075349 ATCAATCTACTTCTCCCATCAGG - Intronic
1057541974 9:95983345-95983367 ATTCCAACTCTTCTCCCAGCTGG + Intronic
1058785734 9:108384917-108384939 ATCACTTCTCATCTCCTGGCTGG - Intergenic
1060553927 9:124498838-124498860 ATCAATCCTCGACTCCCAGATGG + Intronic
1060943689 9:127557723-127557745 GTCACTCCTCTGCTCCAAGAGGG + Intronic
1061888000 9:133602465-133602487 ACCCCTCCTCTTCTGGCAGCTGG + Intergenic
1186195855 X:7109970-7109992 ACCACTCCCCTCCTCCCAGCTGG + Intronic
1186279887 X:7980465-7980487 GTCACTCCTCTCCTCCCAATGGG - Intergenic
1186377674 X:9023930-9023952 GTCACTCCTCTCCTCCCAATGGG + Intergenic
1186883947 X:13893916-13893938 CTCCCTCCTCTTCTCCCAAGGGG + Intronic
1186888986 X:13941615-13941637 TGCCTTCCTCTTCTCCCAGCAGG + Intergenic
1196755705 X:119155516-119155538 ATTCCTCCTCCTCTCCCATCAGG + Intergenic
1196757714 X:119172412-119172434 GTCACCCCTCTACTCCCAGAGGG - Intergenic
1196903050 X:120404975-120404997 ATCATTTCTCTTCTGCCTGCAGG + Intergenic
1198120242 X:133585331-133585353 ATCCCTCCCCTTCTCCGAGCAGG + Intronic
1199060014 X:143344382-143344404 GTCACACCTCTTCTCCCGACTGG + Intergenic
1200105250 X:153708507-153708529 CTCACTCCTCAGCCCCCAGCCGG + Intronic
1200147192 X:153932431-153932453 ATCTCTGCTCTTCTCCCACCAGG - Exonic
1200835366 Y:7726819-7726841 TTTACTCCTCTTCTGCCAGGTGG - Intergenic