ID: 1067082787

View in Genome Browser
Species Human (GRCh38)
Location 10:43221108-43221130
Sequence AGACCCCCGGGTGGAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082787_1067082799 12 Left 1067082787 10:43221108-43221130 CCCATCCCTCCACCCGGGGGTCT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data
1067082787_1067082795 -2 Left 1067082787 10:43221108-43221130 CCCATCCCTCCACCCGGGGGTCT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067082795 10:43221129-43221151 CTGCGGTCCCTCTGCTCTGAAGG No data
1067082787_1067082800 13 Left 1067082787 10:43221108-43221130 CCCATCCCTCCACCCGGGGGTCT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data
1067082787_1067082801 27 Left 1067082787 10:43221108-43221130 CCCATCCCTCCACCCGGGGGTCT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082787_1067082797 5 Left 1067082787 10:43221108-43221130 CCCATCCCTCCACCCGGGGGTCT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082787 Original CRISPR AGACCCCCGGGTGGAGGGAT GGG (reversed) Intronic
900238484 1:1603692-1603714 AGAGCCCCTGGTGGAGAGGTGGG + Intergenic
902834214 1:19036292-19036314 TGACCACCGGGTGAAGGGAGTGG - Intergenic
902955501 1:19922168-19922190 AGACCCTGGGCTGGAGGCATGGG - Intronic
905104927 1:35558509-35558531 AGAGCCCTGGCTGGAGGGGTGGG + Intronic
905301563 1:36989512-36989534 AGGCCCCCGGGAGGAGCGCTTGG - Intronic
905584583 1:39106271-39106293 AGACCCCCGGGGAGATGGAGGGG - Intronic
905945470 1:41897996-41898018 AGGACCCAGGGTGGAGGGAAAGG + Intronic
911299680 1:96157193-96157215 GGACCCCTTGGTTGAGGGATGGG + Intergenic
912490366 1:110059480-110059502 GGACCCCAGGGTGGTGGGAGTGG - Intronic
916674739 1:167055635-167055657 AGACCACCGTGAGGAGGAATAGG - Intronic
917059148 1:171017817-171017839 AGACCCCAGCGAGGAGGGATGGG - Intronic
919847315 1:201650061-201650083 AGACCTGCGGGTGTAGGGGTTGG - Intronic
920201332 1:204261556-204261578 AGAGCCCCAGGTGCAGGGAATGG - Intronic
922570698 1:226633230-226633252 AGACCCCGGGGTGGTGGGGTGGG + Exonic
1062852868 10:759232-759254 AGACCCCCTAGTGCAGGGAAAGG + Intergenic
1063366993 10:5496909-5496931 AGACCTGCGGGTGGGGGGGTGGG - Intergenic
1064554058 10:16530659-16530681 AGGGCTCAGGGTGGAGGGATAGG - Intergenic
1065020243 10:21496655-21496677 AGACCCCCAGCTGGAGAGAAGGG + Intronic
1065712988 10:28534043-28534065 CGAGGCCGGGGTGGAGGGATTGG + Intronic
1065949214 10:30636670-30636692 AGACCTCCTGGTGCAGGGTTTGG - Intergenic
1067082787 10:43221108-43221130 AGACCCCCGGGTGGAGGGATGGG - Intronic
1067217705 10:44316618-44316640 AGAGCCACGGGTGGTGGGAGGGG - Intergenic
1067727091 10:48778622-48778644 AGACCTCCAGGAGGAGGGAACGG - Exonic
1069757222 10:70780630-70780652 AGACCTCCAGGTGGAGGTACGGG - Intronic
1070551459 10:77493895-77493917 AGACTCCAGGGTGGAGTGATTGG - Intronic
1072660901 10:97362980-97363002 AGACCACCTGGTGGAGTCATTGG - Intronic
1074198223 10:111207949-111207971 AGCACCTGGGGTGGAGGGATGGG - Intergenic
1075163153 10:120042035-120042057 AGCCCCCAGGGTGGTGGGCTTGG + Intergenic
1075653110 10:124143001-124143023 AGAGGCCGGGGTCGAGGGATAGG + Intergenic
1076992836 11:284633-284655 AGACCCTCAGGTGGAGGCAGGGG + Exonic
1076994176 11:290222-290244 AGGCCTCCAGGTGGAGGGAAGGG - Intronic
1077053071 11:576357-576379 AGACCCCCGGCTGCAAGGAGTGG + Intergenic
1079102321 11:17549374-17549396 AGACCCCAAGGTGGAGTGAGGGG + Intronic
1079279192 11:19072682-19072704 TGACCCCACGGTGGAGGGTTGGG + Intergenic
1080540273 11:33257916-33257938 CCACCCCGGGGTGGGGGGATCGG + Intronic
1081542317 11:44044885-44044907 AGGCCCCCGGGTGAATGGAAAGG + Intergenic
1083612638 11:64011419-64011441 AGTCCCCAGGGTGAGGGGATGGG + Intronic
1083618322 11:64036886-64036908 AGACCCCGGGGAGGAAGGCTGGG + Intronic
1083838282 11:65287135-65287157 AGACTGCCTTGTGGAGGGATGGG + Intronic
1084435505 11:69136970-69136992 AAACCCCAGCTTGGAGGGATTGG - Intergenic
1084444162 11:69193812-69193834 AGTCAGCAGGGTGGAGGGATGGG + Intergenic
1084547981 11:69823880-69823902 GGGCCCCCAGGTGGAGGGACTGG - Intergenic
1085636847 11:78165602-78165624 AGACCCCTGGGGGGAGGGCTAGG + Intergenic
1089598568 11:119598550-119598572 GCACCCCCAGGTGGAGGGCTGGG + Intergenic
1090801312 11:130174209-130174231 GGGCCCCCAGGAGGAGGGATGGG - Intronic
1092170265 12:6369989-6370011 AGACCAGCGGCTGGAGGGAAGGG + Intronic
1097086783 12:56474768-56474790 GGACCCTCGGGTGTAGGGAAAGG + Exonic
1097173468 12:57129585-57129607 AGAGCCCCGGCTGGAGGCCTGGG + Intronic
1098941059 12:76536697-76536719 AGACCTACAGGTGGAGGGAATGG + Intronic
1101126658 12:101642440-101642462 AGAACCCCAGGTGGACGTATGGG + Exonic
1101874580 12:108589919-108589941 GGAGCCCCAGATGGAGGGATGGG + Exonic
1102507184 12:113390931-113390953 AGACCCGTGTGTGGATGGATGGG - Exonic
1104221216 12:126786733-126786755 AGGCCCCAGGGTGGAGGGAAAGG - Intergenic
1104654286 12:130561539-130561561 AGAACCCTGGGTAGAGGGACGGG + Intronic
1104755465 12:131266646-131266668 AGGCCCCCTGGGGGAGGGAGGGG + Intergenic
1104801618 12:131558613-131558635 AGACCAGGGAGTGGAGGGATGGG - Intergenic
1106410206 13:29506132-29506154 AGCCCCCAGGCTGGAGGGGTGGG - Intergenic
1108662626 13:52600388-52600410 AGCGCCCCGGGCGGAGGGAGAGG - Intergenic
1110706620 13:78606140-78606162 AGATCCCTGGGTGGGGGGATGGG + Intergenic
1112197429 13:97239605-97239627 AGATCCCTGGTTGAAGGGATTGG - Intronic
1122412261 14:101531683-101531705 GGACCCCGGGTTGGAGGGCTAGG + Intergenic
1125602531 15:40923441-40923463 AGACCCCCGGGTGGGAGGCCTGG - Intergenic
1126668471 15:51094851-51094873 AGACAGCCGGGAGGAGGGAGGGG + Intronic
1126795891 15:52260237-52260259 AGACCTCCTGGAGGAGGGCTGGG + Intronic
1129687775 15:77696328-77696350 AGAGTCCGGGGTGGAGGGAAGGG - Intronic
1130339394 15:82986382-82986404 GGACGCCCGGGAGGAGGGAGCGG + Intronic
1132074631 15:98809882-98809904 AGACCCCAGGGTGCGGGGAGTGG - Intronic
1132258646 15:100401473-100401495 AGCTCCCTGGGAGGAGGGATAGG - Exonic
1133168421 16:3964982-3965004 AGACCCCTGGGTGGAGGGTCGGG + Exonic
1137675366 16:50301297-50301319 AAACCCCCATGTGGAGGGAGAGG + Intronic
1140467717 16:75195808-75195830 AGTCCCCGGGGTAGAGGGATGGG - Intergenic
1140837563 16:78809479-78809501 AGTCCTCAGGGTAGAGGGATGGG - Intronic
1141250094 16:82348050-82348072 AGACCCCTGGGAGGAGGAATAGG - Intergenic
1143697209 17:8629987-8630009 CGACCCGTGGGTGGAGGGACAGG - Intronic
1145199101 17:20924504-20924526 AGCCCCCAGAGTGGAGGGAGGGG - Intergenic
1147678529 17:42224078-42224100 AGACCCCAGGGTGAAGTGATGGG + Intronic
1148515201 17:48210502-48210524 AGGCCCCCAGGTGGAGGGCCTGG + Intronic
1148905748 17:50910960-50910982 AGCACCCAGGGTGGAGGGAAGGG + Intergenic
1150452375 17:65279588-65279610 AGACCCCCTGCTGGTGTGATTGG + Intergenic
1150721739 17:67619508-67619530 TGAGCCCCTGGTGGAGTGATTGG - Intronic
1151885969 17:76923585-76923607 AGGCCCATTGGTGGAGGGATGGG - Intronic
1152122655 17:78428237-78428259 AGACTGCAGGGTGGAGGGCTGGG + Intronic
1152558284 17:81065439-81065461 AGACCCAAGGGTGGAGGGCAGGG + Intronic
1152896029 17:82911880-82911902 AGCCCCCAGGGTGAAGGGCTGGG + Intronic
1159995425 18:74960184-74960206 AGAGGACTGGGTGGAGGGATAGG + Intronic
1160910403 19:1471342-1471364 AGAGCCTCGGGTGGAGGGCAAGG - Exonic
1162550417 19:11355413-11355435 AGACTCCGAGGTGGAGGGAGGGG - Intronic
1163748010 19:19059422-19059444 AGTCTCCAGGGAGGAGGGATAGG - Intronic
1164535180 19:29080634-29080656 AGACCCCCAGGAAGAGGGCTGGG + Intergenic
1165407916 19:35642122-35642144 AGACCCCCGGCTGGGGGCAGAGG + Exonic
1166046848 19:40234990-40235012 TGCCCCAGGGGTGGAGGGATGGG - Intronic
1166211235 19:41307945-41307967 AGGCCTCTAGGTGGAGGGATGGG + Intronic
1166689430 19:44813674-44813696 AAGCCCCCGGGTGGAGGGTCAGG - Intronic
1166748932 19:45155633-45155655 AGAGCCCGGGGTAGAGGCATGGG + Intronic
1166881863 19:45934833-45934855 AGACCCTAGGGGTGAGGGATGGG + Exonic
1167103694 19:47418922-47418944 AGACCCAGGGGCGGAGGGAGGGG + Intronic
925379340 2:3414454-3414476 AGACCCCAGGGTGGCGGCAGGGG - Intronic
927515633 2:23670231-23670253 ACACACCCAGGAGGAGGGATTGG + Intronic
928067036 2:28175320-28175342 AGGCCCCCAGGTGGAGTGCTCGG - Intronic
932495992 2:72146044-72146066 GGGCCCCGGGTTGGAGGGATGGG + Intronic
936298684 2:111288042-111288064 AGAGCCCAGAGTGGAGGGAGGGG - Intergenic
937102474 2:119282518-119282540 AGACGCCTGGCTGGAGGGATGGG + Intergenic
939971342 2:148664632-148664654 AGACCAGGAGGTGGAGGGATTGG - Intronic
944150187 2:196549298-196549320 AGACCTCCTGGAGGAGGGAGGGG - Intronic
946313433 2:218895407-218895429 AGTCCCCCAGGAGGAGGGGTAGG + Intronic
947064758 2:226210686-226210708 AGACAACCAGGTGGAGGGAGGGG - Intergenic
948880117 2:240852368-240852390 AGACCCCCGGTAGGAGGGGAGGG - Intergenic
948989291 2:241544051-241544073 AGCCTCCCTGGTGGAGGGAACGG - Intergenic
1168956394 20:1837271-1837293 AGACCCCAGGATTGAGGGCTGGG + Intergenic
1174800216 20:53557176-53557198 CGACCCCCAGGAGGAGGGTTGGG - Intergenic
1175227932 20:57455836-57455858 ACATCCGCTGGTGGAGGGATAGG + Intergenic
1179339597 21:40491889-40491911 AGACCCCCGGGAAGGGGGGTTGG - Intronic
1184459822 22:44630842-44630864 AGGCCCTGGGGAGGAGGGATGGG + Intergenic
1185009866 22:48306892-48306914 AGACCACAGGGTGGCGGGATCGG - Intergenic
1185148450 22:49151535-49151557 TGACCCCCGGGAGGAGGCACAGG - Intergenic
1185179392 22:49350344-49350366 AGAGCCCAGGGAGGAGGGAGAGG + Intergenic
1185265620 22:49901209-49901231 AGACACACAGGTGGATGGATGGG + Exonic
950024413 3:9810448-9810470 AGACGCTGGGGTGGAGGGACTGG + Intronic
950144757 3:10641019-10641041 TGACCCCAGGCAGGAGGGATTGG + Intronic
951249068 3:20373070-20373092 AGACTTCAGGGTGGAGGGAAAGG + Intergenic
952543629 3:34395566-34395588 AGACCCCCTGGTGGAGTGCTTGG + Intergenic
953816684 3:46163697-46163719 AGAGCTCCTGGGGGAGGGATGGG - Intronic
955551871 3:60093794-60093816 AGACCCGGTGGTGGAGGGAGTGG - Intronic
956103704 3:65794677-65794699 GGACAGCAGGGTGGAGGGATAGG - Intronic
958014644 3:87925217-87925239 AGACTCCCTGGTCAAGGGATTGG + Intergenic
958776002 3:98483477-98483499 AGAATCCTGGGTGGAGGGAATGG - Intergenic
964438166 3:156675172-156675194 AGACCCCGGGGGGGAGGGCACGG + Exonic
964636224 3:158860557-158860579 AGAGCCCTGGGTGGAGAGGTGGG - Intergenic
965673777 3:171173883-171173905 AGACTCCCGGGGAGAGGGACTGG - Intronic
968456542 4:703506-703528 AGGCCCGAGGGTGGAGGCATCGG - Intergenic
969470574 4:7385231-7385253 AGACCCCTGAGGGGAGGGGTGGG - Intronic
969656834 4:8503540-8503562 AGCCACCCGGATGGAGGGTTTGG + Intergenic
975824812 4:78308478-78308500 AGACCCACAGCTGGAGGGAAAGG + Intronic
977728573 4:100325465-100325487 AGACCCCTGGGGAGAGGGGTGGG + Intergenic
986124551 5:4873153-4873175 AGTTCTCCGGGTTGAGGGATCGG - Intergenic
986705094 5:10448026-10448048 AGACTCCCTGTTGGAGGGTTGGG - Intronic
992666843 5:79018557-79018579 ACACCCCGGGGATGAGGGATAGG + Intronic
999834217 5:155352216-155352238 AGACCCCAGGCTGGAGGGGGAGG + Intergenic
1002424727 5:179168258-179168280 TGTCCCCCGGGTGGGGGGAGGGG + Intronic
1002465233 5:179405045-179405067 AGAGGCCCAGATGGAGGGATGGG - Intergenic
1008378749 6:50820151-50820173 AGACTCCCGGGTGGCGGGCGCGG + Intronic
1015880250 6:137865046-137865068 AGACCGCCTGGTGGTGGGAGTGG + Intergenic
1019110045 6:169702280-169702302 AGGCCCCGGGGAGGAGGGGTGGG - Exonic
1019292400 7:257179-257201 AGACCCTCCAGTGGAGGGATGGG + Intronic
1019919300 7:4152868-4152890 AGACCCCCAGGGAGAGGGGTTGG + Intronic
1020115856 7:5476025-5476047 AGACCCCCAGGTCCAGGGAAAGG + Intronic
1020892532 7:13897140-13897162 AAAACCCGGGGTGGGGGGATGGG + Intronic
1022508840 7:30922650-30922672 AGACCCACGGGGGGTGGGGTGGG + Intronic
1026991730 7:74589957-74589979 CCACCCCCGGGAGGAGGGCTTGG - Intronic
1029626453 7:101722927-101722949 AGACCCCCGGGTCCCGGGAAGGG - Intergenic
1029658884 7:101945834-101945856 AGACCCATAGGTGGAGGGAAGGG - Intronic
1034184324 7:149162879-149162901 AAACCCCTGGGTGGGGGGAGGGG + Intronic
1035928044 8:3750732-3750754 ACAGCCCCGTGTGGAGGGCTGGG + Intronic
1044940514 8:97337323-97337345 AGACCCCAGGGAGGAGGGAAAGG + Intergenic
1045288400 8:100811459-100811481 AGTCCTCAGGGTGGAGGGAGCGG + Intergenic
1049404252 8:142444610-142444632 AGAGCCCTGGGTGGAGGGACTGG + Intergenic
1049651655 8:143772440-143772462 AGACCCCCGGGTGTACGCAGAGG + Intergenic
1049757899 8:144318917-144318939 ATACCTGGGGGTGGAGGGATGGG + Exonic
1053137137 9:35658354-35658376 CGGCCCACGGGTGGAGGGATCGG - Exonic
1056537679 9:87545236-87545258 AGGCTCCCGGGTGCAGGGTTAGG + Intronic
1057786472 9:98091883-98091905 AGACCCCCGGGAGTGGGGATAGG - Intronic
1059325843 9:113503643-113503665 AGAGCCCAGGGTGCTGGGATGGG + Intronic
1062539556 9:137035562-137035584 GGACCCCCAAGTGGAGGGATTGG + Exonic
1187952580 X:24485480-24485502 AGAGCCCGGGGTGGGGGGATAGG + Intronic
1188490854 X:30737846-30737868 AGCCCCTTGGGTGAAGGGATTGG + Intergenic
1189260418 X:39674737-39674759 AGTCCACAGGGTGGAGGGCTGGG + Intergenic
1189966515 X:46379083-46379105 AAACCCCCAGTTGGAGAGATGGG - Intergenic
1190581110 X:51893818-51893840 AGAATCCAGGGTGAAGGGATCGG - Intronic
1192609662 X:72554759-72554781 AGACCACCAGGTGGAGGCAGGGG - Intronic
1198809964 X:140525087-140525109 TGACCCGGGGGTGGGGGGATAGG - Intergenic