ID: 1067082788

View in Genome Browser
Species Human (GRCh38)
Location 10:43221109-43221131
Sequence CAGACCCCCGGGTGGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082788_1067082795 -3 Left 1067082788 10:43221109-43221131 CCATCCCTCCACCCGGGGGTCTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1067082795 10:43221129-43221151 CTGCGGTCCCTCTGCTCTGAAGG No data
1067082788_1067082800 12 Left 1067082788 10:43221109-43221131 CCATCCCTCCACCCGGGGGTCTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data
1067082788_1067082797 4 Left 1067082788 10:43221109-43221131 CCATCCCTCCACCCGGGGGTCTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082788_1067082801 26 Left 1067082788 10:43221109-43221131 CCATCCCTCCACCCGGGGGTCTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082788_1067082799 11 Left 1067082788 10:43221109-43221131 CCATCCCTCCACCCGGGGGTCTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082788 Original CRISPR CAGACCCCCGGGTGGAGGGA TGG (reversed) Intronic
900093342 1:930050-930072 CAGACCCCCGGGAGATGGAACGG + Intronic
900178616 1:1301821-1301843 CAGACAGCCGGGTGGAGTGCGGG - Intronic
900238483 1:1603691-1603713 CAGAGCCCCTGGTGGAGAGGTGG + Intergenic
900690165 1:3976000-3976022 CATCCCCGCGTGTGGAGGGAGGG + Intergenic
901635917 1:10670075-10670097 CAGACCCCTGGGTTGGGGGTGGG + Intronic
902955502 1:19922169-19922191 CAGACCCTGGGCTGGAGGCATGG - Intronic
904078598 1:27858063-27858085 CATATGCCGGGGTGGAGGGAAGG + Intergenic
904309066 1:29613835-29613857 CAGAGCCCAGGGTGGAGACAGGG + Intergenic
904410142 1:30320190-30320212 CAGGCCCAAGGATGGAGGGACGG + Intergenic
905584584 1:39106272-39106294 CAGACCCCCGGGGAGATGGAGGG - Intronic
906417710 1:45634170-45634192 CAGACTCCCGGCTAGAGGAAAGG + Exonic
906516583 1:46442711-46442733 CTCTCCCCAGGGTGGAGGGAAGG - Intergenic
911413429 1:97540312-97540334 CAGAACCCGGGGTGGGGGGTGGG + Intronic
916165698 1:161965278-161965300 AAGACCCCCTGGTGGCAGGAGGG + Intergenic
916747781 1:167697674-167697696 CAGTCCCCCTGGAGGAGTGAAGG + Exonic
916848051 1:168673447-168673469 CTGGCCCCTGAGTGGAGGGAAGG - Intergenic
917059149 1:171017818-171017840 AAGACCCCAGCGAGGAGGGATGG - Intronic
919905467 1:202075520-202075542 CCTACCCCAGGGTGTAGGGAGGG + Intergenic
920528379 1:206684996-206685018 CAGGCCCCCGGGGGGAGGGAGGG + Intronic
920731945 1:208496068-208496090 CACACCCCCTGGTGGGGAGAAGG - Intergenic
921152024 1:212410314-212410336 CTGACACCAGGGTGCAGGGAAGG + Intronic
922570697 1:226633229-226633251 GAGACCCCGGGGTGGTGGGGTGG + Exonic
1063366994 10:5496910-5496932 CAGACCTGCGGGTGGGGGGGTGG - Intergenic
1064173173 10:13051765-13051787 CAGACCCAGGAGTGAAGGGAAGG + Intronic
1064395820 10:14981261-14981283 CAGTCCCCCGAGAGGAGGAATGG - Intronic
1064901882 10:20304005-20304027 CACAGACCAGGGTGGAGGGATGG - Intergenic
1065020242 10:21496654-21496676 GAGACCCCCAGCTGGAGAGAAGG + Intronic
1067082788 10:43221109-43221131 CAGACCCCCGGGTGGAGGGATGG - Intronic
1067102425 10:43342888-43342910 CAGGCCCTGGGGTGGAGGGTGGG - Intergenic
1067217706 10:44316619-44316641 CAGAGCCACGGGTGGTGGGAGGG - Intergenic
1069358372 10:67613846-67613868 CAGACCCAGGGGTGGAGTGGGGG + Intronic
1069757223 10:70780631-70780653 TAGACCTCCAGGTGGAGGTACGG - Intronic
1070410298 10:76133498-76133520 CAGGCCCCCGGGTGCAGGTAGGG + Intronic
1071661293 10:87505243-87505265 CAGGCCCGCGGGTCCAGGGATGG + Exonic
1072067424 10:91884510-91884532 GTGGCCCCCGGGTAGAGGGAGGG + Intergenic
1074198224 10:111207950-111207972 CAGCACCTGGGGTGGAGGGATGG - Intergenic
1075257686 10:120938707-120938729 CTGTCCTCCTGGTGGAGGGATGG + Intergenic
1075972126 10:126663820-126663842 CAGACCCCTGGGTTCTGGGAGGG - Intronic
1076156252 10:128207780-128207802 CAGACCCACGGGAGGGGGCAGGG - Intergenic
1076230802 10:128818454-128818476 CAGATCACCAAGTGGAGGGAAGG - Intergenic
1076992835 11:284632-284654 CAGACCCTCAGGTGGAGGCAGGG + Exonic
1076994177 11:290223-290245 GAGGCCTCCAGGTGGAGGGAAGG - Intronic
1076998635 11:311258-311280 CAGACCCCCGCGGGGTGGGCGGG + Intronic
1077000108 11:318501-318523 CAGACCCCCGCGGGGTGGGCGGG - Intergenic
1077242302 11:1517027-1517049 CAGGCCCCTGTGGGGAGGGATGG + Intergenic
1077418153 11:2435527-2435549 CAGACAGACGGGTGGATGGATGG - Intergenic
1079102320 11:17549373-17549395 AAGACCCCAAGGTGGAGTGAGGG + Intronic
1079156376 11:17951840-17951862 CTGACCCCTGAGTGGCGGGAAGG - Intronic
1079279191 11:19072681-19072703 CTGACCCCACGGTGGAGGGTTGG + Intergenic
1080658070 11:34273602-34273624 CAGACCTCCGAGGAGAGGGATGG + Intronic
1081538771 11:44014965-44014987 CACATCCCCGGGAGGAGGGGAGG - Intergenic
1082941163 11:58706849-58706871 AAGACCACCAGGTGGAGGCAGGG - Intronic
1083302249 11:61745320-61745342 CAGTGCCCTGGGTGGAAGGAAGG + Exonic
1083612637 11:64011418-64011440 CAGTCCCCAGGGTGAGGGGATGG + Intronic
1083718800 11:64593845-64593867 CATTCCCCCGGGTGGAGAGTGGG - Intronic
1083962205 11:66020782-66020804 CAGGCCCCAGGCTGCAGGGAGGG - Intronic
1083990750 11:66244384-66244406 CAGACCCCGGGTTGGTGAGAGGG - Exonic
1084209986 11:67616386-67616408 CAGAGCGCAGGGTTGAGGGAGGG + Intergenic
1084219303 11:67667692-67667714 CAGACCCTGGGGTGGCTGGAGGG - Intronic
1084786485 11:71444586-71444608 CATACCCCCAGATGGTGGGAAGG + Intronic
1090076491 11:123582878-123582900 CAGACCTCTGGGTGGAGCTAAGG + Intronic
1090351633 11:126111807-126111829 CAGACCTGGGGGTGGAGAGAGGG + Intergenic
1090379782 11:126318409-126318431 CAGGCCAGAGGGTGGAGGGAAGG - Intronic
1091774510 12:3175629-3175651 CAGGCCCCAGGGTCGCGGGAGGG + Intronic
1091968109 12:4762750-4762772 CATACCCACTGGTGGAGTGAAGG + Intronic
1092170264 12:6369988-6370010 GAGACCAGCGGCTGGAGGGAAGG + Intronic
1095507980 12:42918495-42918517 CAGAGCTCTGGGTGGGGGGAAGG - Intergenic
1097173467 12:57129584-57129606 CAGAGCCCCGGCTGGAGGCCTGG + Intronic
1102507185 12:113390932-113390954 CAGACCCGTGTGTGGATGGATGG - Exonic
1103984949 12:124760839-124760861 CAGACCCCCAGAAGCAGGGAGGG + Intergenic
1104654285 12:130561538-130561560 GAGAACCCTGGGTAGAGGGACGG + Intronic
1104755464 12:131266645-131266667 GAGGCCCCCTGGGGGAGGGAGGG + Intergenic
1104858722 12:131913875-131913897 CAGTCCCCCGGCTGGAGGTTGGG + Intronic
1104870834 12:131994300-131994322 CAGGCCCCCAGGTGGGGAGAGGG + Intronic
1105433314 13:20357200-20357222 CAGACACCTGGCTGCAGGGAGGG + Intergenic
1105514060 13:21075573-21075595 AAGACCCCCGCGCGTAGGGAGGG + Intergenic
1105940369 13:25142240-25142262 CAGGCCCCCGGGTGGAAGCAGGG - Intergenic
1110607247 13:77447331-77447353 CAGACGGACGGGTGGACGGACGG - Intergenic
1110706619 13:78606139-78606161 AAGATCCCTGGGTGGGGGGATGG + Intergenic
1113355196 13:109572544-109572566 CAGACCCACGGCTTCAGGGAGGG - Intergenic
1113445195 13:110360786-110360808 CAGGCCCCGGGGTGGGGGGCGGG - Intronic
1113785455 13:113000013-113000035 CAGGCCCCAGAGTGGAGGCAGGG + Intronic
1115700995 14:35952859-35952881 GAGACCACAGGGAGGAGGGAAGG + Intergenic
1119380007 14:74222461-74222483 CAGACCTCCAGGTGAAGGCAGGG - Intergenic
1122403221 14:101479825-101479847 CATACTCTAGGGTGGAGGGAGGG + Intergenic
1122786491 14:104166544-104166566 CACACCCCTTGGTGGGGGGATGG + Intronic
1125520387 15:40345048-40345070 CCCAACCCCGGGTGGAGAGAGGG - Intergenic
1125604127 15:40930431-40930453 GAGAACCCCCGGTAGAGGGAGGG - Intronic
1126342998 15:47664557-47664579 CACACCCCAGTGAGGAGGGACGG - Intronic
1126668470 15:51094850-51094872 GAGACAGCCGGGAGGAGGGAGGG + Intronic
1127054245 15:55115614-55115636 CGCTCCCCAGGGTGGAGGGAAGG - Intergenic
1127847771 15:62886522-62886544 CAGTCCACAGGGTGGAGGGAGGG - Intergenic
1129272221 15:74424978-74425000 CACAACCCCAAGTGGAGGGAGGG + Intronic
1129595969 15:76964596-76964618 CAAAAACCAGGGTGGAGGGAGGG + Intergenic
1129687776 15:77696329-77696351 GAGAGTCCGGGGTGGAGGGAAGG - Intronic
1129775335 15:78233044-78233066 CAGACCCCAGGGAGGAGGGGAGG + Intronic
1131251652 15:90834839-90834861 CCTACCCCCGAGTGGAGGGAGGG - Intergenic
1131801497 15:96074093-96074115 CAAGCCCCCGGGTGGTGGGAAGG - Intergenic
1132341499 15:101081079-101081101 CAGGGCCCAGGGCGGAGGGAAGG - Intergenic
1132342088 15:101085256-101085278 CAGACGCCTGTGTGGAGGGAGGG - Intergenic
1132654014 16:1034260-1034282 TAGACTGCTGGGTGGAGGGATGG - Intergenic
1132691723 16:1184581-1184603 CAGGCCCCCTGGTGGAAGGCAGG + Intronic
1132907375 16:2289654-2289676 CAGCTCCCCGGGTGGGTGGAGGG + Intronic
1132929797 16:2453316-2453338 GAGACGCCCAGGTGGCGGGAGGG - Intronic
1133168420 16:3964981-3965003 GAGACCCCTGGGTGGAGGGTCGG + Exonic
1134093423 16:11403616-11403638 CAGACCCCAGCCTGGAGGCACGG - Intronic
1135005614 16:18819369-18819391 CACAGCCCTGGGAGGAGGGACGG - Intronic
1135895089 16:26393574-26393596 TAGACACCAGGGTGGAGGGAGGG + Intergenic
1135994456 16:27237745-27237767 CAGACACCCCGTTGCAGGGAGGG + Intronic
1137565500 16:49530258-49530280 CAGACCCCTGAGTGTAGTGAGGG - Intronic
1137586832 16:49668758-49668780 CAGGCCCCCAGGAGGAAGGAGGG + Intronic
1137635030 16:49978463-49978485 CAGAGCCCTGGGTGGAGGGAAGG - Intergenic
1138458600 16:57134877-57134899 CAGCTCCCTGGGTGGAGGGAGGG + Intronic
1138580232 16:57936201-57936223 CAGAGGCTAGGGTGGAGGGAGGG - Intronic
1140368671 16:74400411-74400433 CAGATCACCTGGTGGAGGTACGG - Intergenic
1140467718 16:75195809-75195831 GAGTCCCCGGGGTAGAGGGATGG - Intergenic
1140819188 16:78647352-78647374 CAGTCTCCCAGGTGGAAGGAGGG - Intronic
1141470605 16:84235939-84235961 CTGGCTCCCGAGTGGAGGGAGGG + Intronic
1141509670 16:84504450-84504472 CAGGCCCTCGGGTCGGGGGAGGG - Intronic
1141950422 16:87335858-87335880 CAGACACCCGGGTGAAGGATGGG + Intronic
1142032208 16:87844249-87844271 CCAAACCCCGGGTGGGGGGAAGG + Intronic
1142603421 17:1068655-1068677 CACACTCCCGGGTAGAGAGAAGG + Intronic
1142909050 17:3071641-3071663 CAGACCCCAGGGTGGACTGAGGG - Intergenic
1142925512 17:3232601-3232623 CAGACCCCAGGGTGGACTGAGGG + Intergenic
1143103878 17:4518965-4518987 CAGACTTCCCGGTGGAAGGACGG - Intronic
1143669053 17:8383730-8383752 CAGACGCCCAGGTGCAGGGGCGG - Intergenic
1145199102 17:20924505-20924527 AAGCCCCCAGAGTGGAGGGAGGG - Intergenic
1146944362 17:36863906-36863928 CAGGTCCCGGGGTGGGGGGATGG - Intergenic
1147254464 17:39173954-39173976 CCCACCCCCAGGTGGAGGGTGGG + Exonic
1147678528 17:42224077-42224099 GAGACCCCAGGGTGAAGTGATGG + Intronic
1147700207 17:42388770-42388792 CAGAAGCCCGGGGGGAGGGAGGG + Intergenic
1147987535 17:44315100-44315122 CAGACGCGCGGGGGGAGGGGCGG + Intronic
1148135598 17:45289859-45289881 AAGCCTCCCGGGTTGAGGGAAGG + Intronic
1148737074 17:49870922-49870944 CAGAGCCCGGGGTGGATGGTTGG + Intergenic
1148905747 17:50910959-50910981 AAGCACCCAGGGTGGAGGGAAGG + Intergenic
1148959949 17:51384809-51384831 CAGACCCCAGGCAGGATGGAAGG - Intergenic
1149651730 17:58280109-58280131 CAGGCCCACGGGTGGGAGGAAGG + Intronic
1152270964 17:79324659-79324681 CTGGCTCCTGGGTGGAGGGAAGG + Intronic
1152447305 17:80353311-80353333 CAGAGCCCAGGCTGGAAGGAAGG + Intronic
1152558283 17:81065438-81065460 GAGACCCAAGGGTGGAGGGCAGG + Intronic
1152793068 17:82292617-82292639 CAGACCCCGGGGAGGAGCGCAGG + Intergenic
1153997875 18:10456841-10456863 CAGACCCCATGGTGTTGGGAGGG + Intronic
1154241461 18:12657586-12657608 CAGATCCGCGTCTGGAGGGACGG - Exonic
1154475044 18:14747688-14747710 CAGAGCCCAGGGTGGAAGGGCGG + Intronic
1156485202 18:37461195-37461217 CAAGCCCCAGGGTGGAGGCAGGG + Intronic
1157553053 18:48594582-48594604 CAGAGGCCGGGATGGAGGGAGGG - Intronic
1160823514 19:1068788-1068810 CAGACCCAAGGGAGGATGGAGGG + Intronic
1160966860 19:1750500-1750522 GAGTCCCGCGGGTGGAGGGGAGG - Intergenic
1161318500 19:3630370-3630392 CAGACCACGGGGCGGAGGAATGG + Exonic
1161588145 19:5116719-5116741 CAGACCCCAGGGTGGGGGCAGGG + Intronic
1161699555 19:5787368-5787390 GAGACAGGCGGGTGGAGGGAGGG + Intronic
1162550418 19:11355414-11355436 CAGACTCCGAGGTGGAGGGAGGG - Intronic
1162964314 19:14148837-14148859 CAGCTCCCCGGGAGAAGGGAGGG + Exonic
1163635356 19:18434797-18434819 AAGAACCCCAGGTGGAAGGAGGG + Exonic
1164535179 19:29080633-29080655 CAGACCCCCAGGAAGAGGGCTGG + Intergenic
1164609191 19:29620882-29620904 CAGAAGCGCGGGTGGAAGGAAGG - Intergenic
1165261244 19:34620509-34620531 CACACACCAGGGTGGGGGGAGGG + Intronic
1165362696 19:35346469-35346491 TGGACCCCCGGGTGGAATGAAGG + Intronic
1165781128 19:38434828-38434850 CAGGGCCCCGGGGGGAGGGGCGG - Intronic
1166046849 19:40234991-40235013 CTGCCCCAGGGGTGGAGGGATGG - Intronic
1166211234 19:41307944-41307966 CAGGCCTCTAGGTGGAGGGATGG + Intronic
1166748931 19:45155632-45155654 CAGAGCCCGGGGTAGAGGCATGG + Intronic
1166881862 19:45934832-45934854 CAGACCCTAGGGGTGAGGGATGG + Exonic
1167103693 19:47418921-47418943 GAGACCCAGGGGCGGAGGGAGGG + Intronic
1167290778 19:48624356-48624378 CAGACCTAGGGGTGGGGGGAGGG - Intronic
1168056236 19:53866700-53866722 CTGACTCCTGGATGGAGGGAGGG - Intronic
1168148624 19:54433130-54433152 CAGACTCCTTTGTGGAGGGAGGG + Intronic
1168521732 19:57056515-57056537 CAGACCTGAGGGTGGAGGGTGGG + Intergenic
925155735 2:1647957-1647979 CAGAGCCAGGGGTGGATGGACGG - Intronic
925379341 2:3414455-3414477 CAGACCCCAGGGTGGCGGCAGGG - Intronic
926084025 2:10009953-10009975 CAGACCAGCGTGGGGAGGGAGGG - Intergenic
926251997 2:11159993-11160015 CAGACCCCCGCATCCAGGGATGG + Intronic
926784420 2:16506580-16506602 CCTACCCCTGGGTTGAGGGAGGG + Intergenic
927707028 2:25302681-25302703 CAGACCCCCGAGTGTAAGAAAGG + Intronic
928549117 2:32354637-32354659 CAGAGCCCCCAGTGGAGGGTAGG - Intergenic
929576870 2:43057509-43057531 CAGGCTGCTGGGTGGAGGGAAGG - Intergenic
931665953 2:64609573-64609595 CAGATCCCAGGGTGGAGGCGGGG - Intergenic
932412375 2:71554998-71555020 CAGATCAGCAGGTGGAGGGAAGG + Intronic
933009107 2:77035209-77035231 CACACACCGGGGTGGGGGGAAGG - Intronic
933278239 2:80304689-80304711 CACACTGCCTGGTGGAGGGAAGG - Exonic
934572297 2:95380515-95380537 AGGACCCCAGGGTGCAGGGAGGG + Intronic
936298685 2:111288043-111288065 GAGAGCCCAGAGTGGAGGGAGGG - Intergenic
937102473 2:119282517-119282539 GAGACGCCTGGCTGGAGGGATGG + Intergenic
937915525 2:127097060-127097082 CAGACCCCCGAGTGGGGAGTGGG - Intronic
937923172 2:127146561-127146583 CAGACTACCTGGTGGAGGGGAGG - Intergenic
943767409 2:191677964-191677986 CAGCCCCCGGGGAGGAGCGAGGG + Intergenic
944150188 2:196549299-196549321 GAGACCTCCTGGAGGAGGGAGGG - Intronic
947064759 2:226210687-226210709 AAGACAACCAGGTGGAGGGAGGG - Intergenic
948587196 2:239026865-239026887 GAGAGCCCCGTGTGGATGGATGG - Intergenic
948664552 2:239526879-239526901 CAGAACTTCGGGCGGAGGGACGG - Intergenic
948880118 2:240852369-240852391 AAGACCCCCGGTAGGAGGGGAGG - Intergenic
1170665479 20:18382624-18382646 CAGACCTCAGGGAGCAGGGAGGG - Intergenic
1170914965 20:20613783-20613805 CAGAGCCCTGAGTGAAGGGAAGG - Intronic
1171108641 20:22459886-22459908 CAGACATGCAGGTGGAGGGAAGG + Intergenic
1172093748 20:32450765-32450787 CAGACCCCCATGTGTAGGGGGGG + Intronic
1172881488 20:38202708-38202730 CTGACCTGGGGGTGGAGGGAAGG + Intergenic
1172883173 20:38214706-38214728 CAGAGGCTCGGCTGGAGGGAGGG - Intronic
1173858771 20:46268538-46268560 CCGAGCCCGGGGTGGTGGGAGGG - Intronic
1174633739 20:51980812-51980834 CAGACCCGCTGGTAGGGGGATGG - Intergenic
1174800217 20:53557177-53557199 CCGACCCCCAGGAGGAGGGTTGG - Intergenic
1175987155 20:62769866-62769888 CAGAACCCTGGGGGTAGGGAGGG + Intergenic
1176107305 20:63395541-63395563 CATGGCCCCGGCTGGAGGGAAGG + Intergenic
1176118685 20:63444544-63444566 AAGAGCCCTGGGTGGAGGGATGG - Intronic
1178806236 21:35841876-35841898 AATACCCACGTGTGGAGGGAGGG + Intronic
1179835890 21:44032889-44032911 CAGGAGCCAGGGTGGAGGGAGGG - Intronic
1180626046 22:17194251-17194273 CCGACTCCCGGGAGGAGGAAGGG - Intronic
1180645744 22:17337438-17337460 CAGACACAAGGGTGGAGGGATGG - Intergenic
1180920864 22:19520923-19520945 GAGACCCACAGGTGGAGGGATGG - Intergenic
1181532980 22:23527642-23527664 CCGAGACCTGGGTGGAGGGAGGG + Intergenic
1182321550 22:29481151-29481173 CAGGCGCGCGGGTGGGGGGAGGG + Intronic
1182777478 22:32841514-32841536 GAGAGCCCCGGGTGCAGGGAAGG + Intronic
1183260886 22:36795141-36795163 CAGGCCCCCGGGAGGATGCAGGG + Intergenic
1183418746 22:37697774-37697796 CAGAGCCCCAGGGGGAGGGTGGG - Intronic
1183495589 22:38141772-38141794 CACACCCCCGCATGGAGGCAGGG + Intronic
1184459821 22:44630841-44630863 CAGGCCCTGGGGAGGAGGGATGG + Intergenic
950643004 3:14360487-14360509 CAGGCCCCCAGGAGGAGGCAAGG - Intergenic
950899326 3:16482994-16483016 CAGAAGCCCTGGAGGAGGGAAGG - Intronic
953607986 3:44424374-44424396 CAGACCCAGGGGAGTAGGGAGGG - Intergenic
953881718 3:46694357-46694379 CAGACCCCCCGGGAGCGGGAGGG + Intergenic
953994530 3:47509495-47509517 CAGACCCCAGTGTGGGGAGAGGG - Intronic
954256730 3:49412398-49412420 CAGTACCCCGGGTGGGGCGAGGG + Exonic
954300696 3:49699382-49699404 CAGGCCCCGGGGTGGGGGGTGGG + Intronic
955769400 3:62373186-62373208 CAGAGGCCCGGGTCCAGGGAAGG - Intronic
961467212 3:127089236-127089258 CTGACCCCGCGGTGAAGGGAGGG + Intergenic
962283240 3:134067418-134067440 CAGTGCCCCGGGTGTGGGGAGGG + Intronic
962763571 3:138541072-138541094 CAGACACTGGGGTGGAGGGTGGG + Intronic
963357299 3:144225188-144225210 CAGACTCCTGAGGGGAGGGAGGG - Intergenic
965520278 3:169663212-169663234 CGGGGCCCCGGGTGGAGGGCAGG - Intronic
967293590 3:187944967-187944989 CAGACCCTCGTGTGGAGGCTTGG + Intergenic
967849747 3:194072643-194072665 CAGACCCCAGGGCGCAGGAAGGG + Intergenic
968028336 3:195461979-195462001 CTGTTCCACGGGTGGAGGGAAGG - Intergenic
968551745 4:1226853-1226875 GAGACCCCCAGATGGAGGCATGG + Intronic
968606361 4:1537564-1537586 CAGACCCCTGGGTAGGGGGTCGG + Intergenic
968986717 4:3879655-3879677 CAAAGCCCCGGGTGGAGGCCCGG + Intergenic
973759053 4:54100548-54100570 CAGACCCCCGAGAGGAGTGCAGG - Exonic
975441801 4:74419711-74419733 CAGACCAGGGGGTGGGGGGATGG + Intergenic
977728572 4:100325464-100325486 CAGACCCCTGGGGAGAGGGGTGG + Intergenic
978189600 4:105896127-105896149 CAGGCCCCCGGGGGGAGGCCCGG + Intronic
978201948 4:106032793-106032815 AAGACCACCAGGTGGAGGCAGGG + Intergenic
978327861 4:107579403-107579425 CGAGCCCCCGGGTGGAGGGGCGG + Intergenic
980987560 4:139710542-139710564 CTGATTCCGGGGTGGAGGGAGGG - Intronic
981153698 4:141409094-141409116 CACACACACGGGGGGAGGGAGGG - Intergenic
984645055 4:182210156-182210178 CACACCCTCGGGCGGATGGACGG + Intronic
985980225 5:3456553-3456575 CAGCCAGCCGGGAGGAGGGAGGG + Intergenic
986679577 5:10221106-10221128 AAGACCCCCCCATGGAGGGATGG + Intergenic
987640140 5:20601862-20601884 AAGACCACCAGGTGGAGGCAGGG - Intergenic
988978130 5:36535961-36535983 CTGACCAGCGGATGGAGGGATGG - Intergenic
989631078 5:43483594-43483616 CAGACCCCAGGGCCGCGGGACGG + Intronic
992084853 5:73269375-73269397 CAGACCTTCAGGTGCAGGGAAGG - Intergenic
995559189 5:113362857-113362879 ATGACTCCAGGGTGGAGGGAGGG + Intronic
995722512 5:115151413-115151435 AAGACCCCTGGGTGGGGGCAGGG - Intronic
996639599 5:125736271-125736293 CAGACAGCAGGCTGGAGGGATGG + Intergenic
997285668 5:132676453-132676475 AAGACCCCCGGGTGCAGGCCAGG + Intronic
997384159 5:133459274-133459296 CGGACCCCAGGGTGGTGGAAAGG - Intronic
999272185 5:150302935-150302957 CCGAGCCCCAGGTGGAGGGGCGG + Exonic
999431825 5:151531404-151531426 CTGGCCCCAGGGTGGAAGGAGGG + Intronic
1001818814 5:174693757-174693779 CTGACCCCTGGGTTGAGAGATGG + Intergenic
1002188910 5:177468893-177468915 CAGAGCCCTGGGGAGAGGGAGGG + Exonic
1002424726 5:179168257-179168279 ATGTCCCCCGGGTGGGGGGAGGG + Intronic
1006315815 6:33290842-33290864 CTGACCCCATGGTGGGGGGAGGG + Exonic
1007269369 6:40624471-40624493 CTGACACCCGGGTGGAGGCGGGG - Intergenic
1011182490 6:84636539-84636561 CACACACCGGGGTGGGGGGAGGG - Intergenic
1017770533 6:157640647-157640669 CAGTCCCCTGGTGGGAGGGAGGG - Intronic
1017874067 6:158509741-158509763 CAGGCCCCTGGGTAGAGGGGAGG - Exonic
1018100166 6:160430921-160430943 CAGAGCCCAGAGTGGGGGGAGGG + Intronic
1018802782 6:167236378-167236400 CAGGGCAGCGGGTGGAGGGAGGG + Intergenic
1019170432 6:170130534-170130556 CAGGCCCCCGGCTGCAGGGAGGG + Intergenic
1019292399 7:257178-257200 CAGACCCTCCAGTGGAGGGATGG + Intronic
1019477217 7:1249733-1249755 CAGGCCCAGGGCTGGAGGGAGGG + Intergenic
1020004336 7:4774338-4774360 AAGACCCCTGGATGGAAGGAAGG - Intronic
1020137504 7:5595025-5595047 CAGAGGCCCCGCTGGAGGGAGGG + Intronic
1020243987 7:6416632-6416654 CAGCCCCCGGGGTGGGGAGAAGG + Exonic
1020892531 7:13897139-13897161 CAAAACCCGGGGTGGGGGGATGG + Intronic
1022316443 7:29249409-29249431 CAGACCCCCAGCTGGTTGGATGG + Intronic
1022563582 7:31374382-31374404 CAGTGGCCCCGGTGGAGGGAGGG - Intergenic
1023782090 7:43665857-43665879 AATACCCACGTGTGGAGGGAGGG - Intronic
1025790232 7:64681548-64681570 CAGACCCTGGGGTTGAGGAAGGG - Intronic
1028318820 7:89436115-89436137 CAGTCCCCTGGTTGCAGGGAGGG - Intergenic
1029169325 7:98619616-98619638 CAGCCACCGGGGAGGAGGGAGGG - Intronic
1029604243 7:101589126-101589148 CAGGACGCCGGGTGCAGGGAAGG - Intergenic
1029626454 7:101722928-101722950 CAGACCCCCGGGTCCCGGGAAGG - Intergenic
1029629113 7:101739459-101739481 CTGAGCCCTGGGTGGAGGGCGGG + Intergenic
1029658885 7:101945835-101945857 CAGACCCATAGGTGGAGGGAAGG - Intronic
1033684131 7:143623280-143623302 CAGGACCCCAGGAGGAGGGAGGG - Intronic
1033687307 7:143702499-143702521 CAGGACCCCAGGAGGAGGGAGGG - Intronic
1033700481 7:143834343-143834365 CAGGACCCCAGGAGGAGGGAGGG + Intergenic
1034184323 7:149162878-149162900 CAAACCCCTGGGTGGGGGGAGGG + Intronic
1034974822 7:155441937-155441959 CAGAGCCCTGGGAGGGGGGAGGG - Intergenic
1036776014 8:11613613-11613635 CAGACCCCCGGAGCCAGGGAGGG + Intergenic
1038908768 8:31937901-31937923 AAGACCACCAGGTGGAGGCAGGG - Intronic
1039486754 8:37916189-37916211 CTGGCCCCAGGGAGGAGGGAGGG - Intergenic
1044828285 8:96219857-96219879 CTGCCTCCTGGGTGGAGGGAAGG + Intergenic
1045673975 8:104588600-104588622 CAGACCCTCGGGTGGTGGAGAGG - Intronic
1047890416 8:129302850-129302872 AAGACCACCGGGTGGGGGCAGGG + Intergenic
1049164458 8:141117643-141117665 CGGGCCCCCAGGTGGAGGCAGGG - Intronic
1049359546 8:142205789-142205811 CAGACCCCAGAGTGGACGGTGGG + Intergenic
1049553391 8:143270906-143270928 CTGACGCCCAGGTGGAGGGTGGG + Intronic
1049689604 8:143952875-143952897 CAGGCCCCTGGCTGGTGGGAGGG - Intronic
1049757898 8:144318916-144318938 CATACCTGGGGGTGGAGGGATGG + Exonic
1051604994 9:18909764-18909786 CAGACCCTGGGGTGGAGGCTGGG - Exonic
1051658194 9:19402704-19402726 CAGAGCACTGGGGGGAGGGAGGG - Intergenic
1052864997 9:33459538-33459560 CAGAACCCCAGGGGAAGGGAAGG - Intergenic
1052878717 9:33586844-33586866 CAGACCACAGGGTGGTGAGATGG - Intergenic
1053311814 9:37025341-37025363 CAGAGACCCGGCTGGAGTGAAGG - Intronic
1057815174 9:98289126-98289148 CACACCCCCGGCTGTAGGGAGGG + Exonic
1059325842 9:113503642-113503664 CAGAGCCCAGGGTGCTGGGATGG + Intronic
1059937146 9:119322612-119322634 CAGGCACCTGGGCGGAGGGAGGG - Intronic
1060135938 9:121153767-121153789 CAGACCCCAGGGTGGTAGGGAGG + Intronic
1060936971 9:127521647-127521669 CAGTCCGCAGGGTGGAAGGAAGG + Intronic
1061247488 9:129408188-129408210 CTGAGACCTGGGTGGAGGGAGGG - Intergenic
1061263255 9:129491428-129491450 CAGGCCCCAGGATGGAGGGAGGG + Intergenic
1061416067 9:130447563-130447585 GAGACACCTGGGAGGAGGGAAGG - Intronic
1061668010 9:132171643-132171665 CAGACCCCCTGGGGGAGGAATGG - Intronic
1061838369 9:133343636-133343658 CAAACCCCAGTGTGGAGGCAGGG - Intronic
1062365126 9:136204762-136204784 CAGATCCCAGGGTGGCGGGGAGG - Intronic
1062389183 9:136327362-136327384 CAGTCCCCGGGGAGGGGGGAGGG - Intergenic
1062716806 9:138014779-138014801 CATACCCCCAGGAGGAGGCAGGG - Intronic
1187056972 X:15749852-15749874 CACACCCTGAGGTGGAGGGAGGG - Intronic
1189260417 X:39674736-39674758 CAGTCCACAGGGTGGAGGGCTGG + Intergenic
1192189467 X:68982029-68982051 CAAAACCCCTGGTGGAGGGTAGG - Intergenic
1192609663 X:72554760-72554782 AAGACCACCAGGTGGAGGCAGGG - Intronic
1193777798 X:85665039-85665061 CACACACCAGGGTGGGGGGAGGG + Intergenic
1197549597 X:127873575-127873597 CAGACCAGGGGGTGGAGGGATGG + Intergenic
1198280170 X:135133742-135133764 CAGACTCCGGGGTGGGGGGTGGG + Intergenic
1198290788 X:135238772-135238794 CAGACTCCGGGGTGGGGGGTGGG - Intergenic
1200128571 X:153829628-153829650 CAGGGCCCCGCGGGGAGGGAAGG - Intronic
1201786879 Y:17794012-17794034 CACAGCCCCAGGAGGAGGGAGGG + Intergenic
1201814674 Y:18111976-18111998 CACAGCCCCAGGAGGAGGGAGGG - Intergenic
1202330954 Y:23752387-23752409 CACAGCCCCAGGAGGAGGGATGG + Intergenic
1202539815 Y:25917674-25917696 CACAGCCCCAGGAGGAGGGATGG - Intergenic