ID: 1067082790

View in Genome Browser
Species Human (GRCh38)
Location 10:43221113-43221135
Sequence ACCGCAGACCCCCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082790_1067082801 22 Left 1067082790 10:43221113-43221135 CCCTCCACCCGGGGGTCTGCGGT 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082790_1067082795 -7 Left 1067082790 10:43221113-43221135 CCCTCCACCCGGGGGTCTGCGGT 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1067082795 10:43221129-43221151 CTGCGGTCCCTCTGCTCTGAAGG No data
1067082790_1067082799 7 Left 1067082790 10:43221113-43221135 CCCTCCACCCGGGGGTCTGCGGT 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data
1067082790_1067082800 8 Left 1067082790 10:43221113-43221135 CCCTCCACCCGGGGGTCTGCGGT 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data
1067082790_1067082797 0 Left 1067082790 10:43221113-43221135 CCCTCCACCCGGGGGTCTGCGGT 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082790 Original CRISPR ACCGCAGACCCCCGGGTGGA GGG (reversed) Intronic
902801095 1:18830768-18830790 ACCCCAGACCCCGCGGTGGTAGG + Intergenic
903190268 1:21652136-21652158 GCCGCAGACCCTCTGTTGGAGGG + Intronic
904026282 1:27505590-27505612 AAGGCAGACCCGCAGGTGGAAGG - Intergenic
905627572 1:39498780-39498802 CCCCCAGAGCCCCGGGTGCATGG - Intronic
905668852 1:39778328-39778350 CCCCCAGAGCCCCGGGTGCATGG + Intronic
906193860 1:43916695-43916717 ACCTCAGCCCCCCGAGTGGCTGG + Intronic
907179666 1:52558431-52558453 ACCTCAGCCCCCCGAGTGGCTGG + Intergenic
908605303 1:65792241-65792263 GACGCAGACCCCCGGGTTGGGGG - Intergenic
921765144 1:218963235-218963257 ACCTCAGACCCCCGAGTAGCTGG - Intergenic
923056906 1:230433358-230433380 ACCTCAGACCCCTGAGTAGATGG - Intergenic
1065185431 10:23166043-23166065 ACCTCAGCCTCCCGGGTGGCTGG - Intergenic
1067082790 10:43221113-43221135 ACCGCAGACCCCCGGGTGGAGGG - Intronic
1071140842 10:82507584-82507606 ACAGCAGACCCAAGGGTGGGAGG + Intronic
1072800391 10:98388710-98388732 ACCCCAGACCCCCGAATGCATGG + Intronic
1076904854 10:133356675-133356697 CCTGCAGACCCCAGTGTGGACGG - Exonic
1077043631 11:535198-535220 CCCGCAGGCCCCAGGGAGGAAGG + Intronic
1083180549 11:60982100-60982122 ACAGCAGATGCCCGGGTGGGGGG + Intronic
1083618320 11:64036881-64036903 ACTGGAGACCCCGGGGAGGAAGG + Intronic
1087161447 11:94951680-94951702 TCCCCAGACCCCAGGGAGGATGG - Intergenic
1087282536 11:96227985-96228007 ACCTCAGCCCCCCGAGTGGCTGG - Intronic
1091358233 11:134954680-134954702 CCCGTAGACCCCCTGATGGAAGG + Intergenic
1091769667 12:3142676-3142698 ACCGCAGGCACCCGGGGGCAGGG - Intronic
1093847374 12:23989275-23989297 ACCTCAGCCCCCCGAGTGGCAGG - Intergenic
1096475498 12:51906967-51906989 ACCGAGGACCCCCGGGCTGAGGG + Intronic
1098038275 12:66328446-66328468 ACCTCAGACCCCCGAGTAGCTGG - Intronic
1098572263 12:72001538-72001560 GCCTCAGCCCCCCGGGTAGATGG + Intronic
1102141170 12:110616364-110616386 ACCTCAGACTCCCGGGTAGCTGG + Intronic
1104069142 12:125329514-125329536 ACCCCAGACCCAAGGGTGGAGGG - Intronic
1105298705 13:19114221-19114243 ACCGCAGTCTCCCAGGTGGCTGG - Intergenic
1107378270 13:39828253-39828275 ACCTCAGACTCCCAGGTGGCTGG - Intergenic
1107855216 13:44608397-44608419 ACCTCAGCCTCCCGGGTGGCTGG - Intergenic
1107933823 13:45328157-45328179 ACCGCAGTCCCCCAAGTGGCTGG + Intergenic
1110311758 13:74058079-74058101 ACCGCAGCCTCCCGGGTAGCTGG + Intronic
1114007792 14:18332974-18332996 AGAGCAGAGCCCTGGGTGGAAGG + Intergenic
1115431480 14:33324081-33324103 ACCGCAGGCACCTGAGTGGAAGG + Intronic
1117813775 14:59576654-59576676 ACCGAGGAGCCCAGGGTGGAGGG + Exonic
1118644714 14:67826795-67826817 ACCGCAGCCTCCCGAGTGGCTGG + Intronic
1126841711 15:52723605-52723627 ACCGCAGGCACCTGGGTGGGAGG - Intergenic
1127008388 15:54595450-54595472 ACCACAGACCCCCTGAAGGAAGG - Intronic
1128388152 15:67165153-67165175 ACCGCAGACCCTCGGGGGGATGG - Intronic
1129393879 15:75234031-75234053 CCCCCAGTCCCCCGGGTGGCAGG - Intergenic
1129605798 15:77024417-77024439 ACCGGACAGCCCTGGGTGGAGGG - Intronic
1129775332 15:78233040-78233062 CCCACAGACCCCAGGGAGGAGGG + Intronic
1133396238 16:5449721-5449743 ACCTCAGCCCCCCGAGTAGATGG + Intergenic
1134152266 16:11814450-11814472 ACCTCAGCCTCCTGGGTGGATGG + Intergenic
1134242605 16:12517134-12517156 ACAGCAGAGCCACGGGTGGGTGG + Intronic
1137787933 16:51152470-51152492 GCCGCAGAGCCCCGGGCGGGCGG + Intergenic
1139717596 16:68825929-68825951 ACCTCAGACCCCTGGGTGGCTGG + Intronic
1145037503 17:19551552-19551574 ACCAGGGACCCCAGGGTGGAGGG + Intronic
1145965543 17:28914144-28914166 TCAGCAGACCCCAGAGTGGATGG - Intronic
1147987533 17:44315096-44315118 AGCGCAGACGCGCGGGGGGAGGG + Intronic
1148737072 17:49870918-49870940 TCCTCAGAGCCCGGGGTGGATGG + Intergenic
1148899587 17:50866080-50866102 ACCACAGACCCGCGGCTGGGCGG + Exonic
1148899802 17:50866840-50866862 GCCGCAGACCCCCGCGGAGAGGG - Intronic
1149766113 17:59280079-59280101 ACCGCAGACCCCTGAGTAGCTGG + Intergenic
1151766910 17:76137531-76137553 ACCGAAGGCCCCCAGGTGGCAGG + Exonic
1154475042 18:14747684-14747706 AGAGCAGAGCCCAGGGTGGAAGG + Intronic
1154529671 18:15330989-15331011 AGAGCAGAGCCCCGGGTGGAAGG - Intergenic
1155195049 18:23466573-23466595 ACCTCAGCCCCCCGGGTAGCTGG - Intronic
1158450068 18:57556455-57556477 ATCACAGACCCCCGGGTGTGAGG + Intronic
1161114311 19:2488353-2488375 ACCGCCGGCGTCCGGGTGGAGGG - Intergenic
1161668376 19:5590483-5590505 ACTGCAGGCCCCAGGGTGGCAGG + Intronic
1164315692 19:24086386-24086408 ACCTCAGCCCCCCGGGTTCAAGG + Intronic
1164609193 19:29620886-29620908 TCCGCAGAAGCGCGGGTGGAAGG - Intergenic
1167450887 19:49568371-49568393 ACCGCAGTTCCCCGGGTGTTAGG - Intronic
1168037027 19:53728021-53728043 ACCGCAGATCCCGGGGTGGGAGG + Intergenic
1168400425 19:56083085-56083107 GCCTCAGCCCCCCGAGTGGATGG + Intergenic
925331188 2:3059973-3059995 ACAGCAGACCCCAGGGGGAAAGG + Intergenic
926120216 2:10237643-10237665 GCCGCAGCCCCCCGGGCTGAGGG + Intergenic
927490354 2:23517167-23517189 ACGGCAGACCCCCGGGCTGGAGG - Intronic
933947474 2:87299021-87299043 ACCACAAACCCCAGGATGGAAGG - Intergenic
934547798 2:95233312-95233334 ACCTCAGCCTCCCGGGTGGCTGG + Intronic
936332721 2:111562546-111562568 ACCACAAACCCCAGGATGGAAGG + Intergenic
938528764 2:132162429-132162451 AGAGCAGAGCCCCGGGTGGAAGG - Intronic
939059354 2:137400953-137400975 TCCTCAGACCCCCGGTTGAATGG + Intronic
947712496 2:232324021-232324043 ACCGCAGAGCCCTGGGAGGCAGG - Intronic
947719888 2:232363836-232363858 ACCGCAGGGCCCCGGGAGGCAGG - Intergenic
947731456 2:232433701-232433723 ACCGCAGGGCCCCGGGAGGCAGG - Intergenic
1170631976 20:18073661-18073683 ACCTCAGCCCCCCGAGTAGATGG - Intergenic
1172047026 20:32087399-32087421 ACCCCAGCCCCCCGAGTGGCTGG + Intronic
1172695557 20:36820256-36820278 ACTGCAGACTCCCTGGAGGAAGG + Intronic
1174386440 20:50190699-50190721 GCCCGAGACCCCCGGGAGGACGG - Intergenic
1176286177 21:5020664-5020686 TCCGCAGTCCCGCGGGTGGAGGG + Intergenic
1176767739 21:13037483-13037505 AGAGCAGAGCCCCGGGTGGAAGG + Intergenic
1179344340 21:40542943-40542965 ACCGCAGAGGCCCGGGTGAGGGG - Intronic
1179544743 21:42106551-42106573 ACCCCAGGCCCCGGGATGGACGG - Intronic
1179824716 21:43957524-43957546 ACCCGAGACCCCCGTGTGGAGGG - Intronic
1179824727 21:43957551-43957573 ACCCGAGACCCCCGTGTGGAGGG - Intronic
1179824746 21:43957597-43957619 ACCCGAGACCCCCGCGTGGAGGG - Intronic
1179824765 21:43957651-43957673 ACCCGAGACCCCCGTGTGGAGGG - Intronic
1179824777 21:43957678-43957700 ACCCGAGACCCCCCTGTGGAGGG - Intronic
1179824787 21:43957705-43957727 ACCAGAGACCCCCGTGTGGAGGG - Intronic
1179824805 21:43957750-43957772 ACCCGAGACCCCCGTGTGGAGGG - Intronic
1179824824 21:43957804-43957826 ACCCGAGACCCCAGTGTGGAGGG - Intronic
1179871004 21:44242811-44242833 TCCGCAGTCCCGCGGGTGGAGGG - Intergenic
1179983255 21:44907290-44907312 ACAGCAGACCCCTGGGGGGCAGG + Intronic
1180259870 21:46661927-46661949 CCCGCACACTCACGGGTGGAAGG - Exonic
1180432298 22:15263784-15263806 AGAGCAGAGCCCTGGGTGGAAGG + Intergenic
1180514861 22:16131721-16131743 AGAGCAGAGCCCCGGGTGGAAGG + Intergenic
1180936106 22:19626186-19626208 ATAGCAGACCCCAGGGAGGATGG - Intergenic
1181786849 22:25233447-25233469 ACCGGAGGCCCGGGGGTGGAGGG - Intergenic
1182472060 22:30554831-30554853 ACCTCAGACCCCGGGGTGAGGGG - Exonic
1182845060 22:33423644-33423666 ACAGCAGAGCCCAGGCTGGAGGG - Intronic
1183480676 22:38063269-38063291 ACCTCAGACCCCCGAGTAGCTGG + Intronic
1184111003 22:42395057-42395079 ACCTCAGCCTCCCGGGTGGCTGG - Intronic
1185025050 22:48404075-48404097 AACACAGACCCCCGCATGGAGGG + Intergenic
1185166900 22:49266930-49266952 AGCTCAGACACCCGGGTGCAGGG + Intergenic
949335526 3:2970559-2970581 ACCTCAGCCTCCCGGGTGGTTGG + Intronic
949460265 3:4284295-4284317 ACCTCAGCCCCCCGGGTAGCTGG - Intronic
957118915 3:76063457-76063479 ACCTCAGACCCCTGGGTAGCTGG + Intronic
960848021 3:122022320-122022342 GCCGCAGTCCCCCGGGAGGCGGG - Intergenic
968489337 4:881722-881744 GCCGCAGAGCCCGGGGAGGATGG - Intronic
969713709 4:8858614-8858636 AGCGCAGGCCCCCGGGCGGCCGG + Intronic
973248502 4:48036811-48036833 ACCTCAGGCTCCCGGGTGGCTGG - Exonic
979438945 4:120728069-120728091 ACTGCTGACCCCGGGGTGAAAGG + Intronic
982027396 4:151264314-151264336 ACCTCAGCCTCCCGGGTGGCTGG - Intronic
985575634 5:672253-672275 ACCGCAGACCCCAGGGAGCCTGG + Intronic
990300376 5:54444003-54444025 ACCTCAGCCCCCCGGGTAGCTGG + Intergenic
993879057 5:93341839-93341861 ACCGCAGCCCCCTGGATTGAAGG + Intergenic
997333162 5:133082578-133082600 ACCTCAGACCCCCAAGTAGATGG + Intronic
999834214 5:155352211-155352233 AATGCAGACCCCAGGCTGGAGGG + Intergenic
1001512860 5:172336010-172336032 CCAGCTGACCCCCGGGAGGAAGG + Exonic
1001605141 5:172954446-172954468 ACCGCAGCCTCCCAGGTGGCTGG - Intergenic
1013271412 6:108548960-108548982 ACCTCAGACTCCCGGGTAGCTGG + Intergenic
1016330676 6:142948938-142948960 ACCTCAGCCTCCCGAGTGGAGGG + Intergenic
1017579746 6:155850618-155850640 CCCTCAGACACCAGGGTGGAAGG + Intergenic
1018728885 6:166634317-166634339 GCCGCAGACCCACGGGCTGAGGG + Intronic
1018736060 6:166688089-166688111 GCCGCAGACCTCAGGGTGGGAGG + Intronic
1019436159 7:1023302-1023324 TCCGCAGACCCCGCGGTGGCGGG - Intronic
1026646181 7:72171040-72171062 ACCTCAGCCCCCCGAGTGGTTGG - Intronic
1026968608 7:74454744-74454766 GCCGCTGAATCCCGGGTGGAGGG + Intronic
1029440635 7:100585014-100585036 TCCACAGACACCAGGGTGGAGGG + Intronic
1029443464 7:100600680-100600702 ACCCCAGGACCCCGGGGGGATGG + Exonic
1029716090 7:102326995-102327017 ACCTCAGACTCCCAGGTGGCTGG - Intergenic
1030047491 7:105510626-105510648 ACCTCAGCCTCCCGGGTGGCTGG + Intronic
1032816769 7:135483707-135483729 ACCTCAGCCCCCCGAGTGGTTGG - Intronic
1033200860 7:139368621-139368643 ACCTCAGCCTCCCGGGTGGCTGG - Intronic
1035253147 7:157610283-157610305 ACCTGAGACCCCTGAGTGGAAGG - Intronic
1035287381 7:157815008-157815030 AACGCAGGGCCCCGTGTGGAAGG - Intronic
1035977492 8:4329401-4329423 ACCGCAGCCTCCCGGGTAGCTGG + Intronic
1039846757 8:41330794-41330816 ACCAGAGACCCCCTGGCGGAGGG - Intergenic
1042183303 8:66113154-66113176 ACCCCAGACACCTGGGTTGAGGG + Intergenic
1043393389 8:79812702-79812724 ACCTCAGACCCCTGAGTAGATGG - Intergenic
1044424745 8:92038162-92038184 ACCTCAGCCTCCCGGGTAGATGG + Intronic
1053265687 9:36711538-36711560 ACAGCAGACTCCTGGGTAGATGG - Intergenic
1053707379 9:40768758-40768780 AGAGCAGAGCCCCGGGTGGAAGG - Intergenic
1054417293 9:64889526-64889548 AGAGCAGAGCCCCGGGTGGAAGG - Intergenic
1055935172 9:81598031-81598053 ACCACAGACCCCAGAGAGGACGG + Intronic
1057229448 9:93310847-93310869 ACCTCAGCCTCCCGGGTGGCTGG - Intronic
1061149580 9:128821190-128821212 ACTGCAGACCTGCGGGGGGAAGG - Exonic
1061149591 9:128821229-128821251 ACCGCAGACCTGCAGGGGGAAGG - Exonic
1062370277 9:136235241-136235263 ACAGCACACCCCCCGGAGGAGGG + Intronic
1187888014 X:23907479-23907501 GCGGGAGACCCCCGGGTGGGTGG - Intronic
1190770620 X:53511151-53511173 ACCTCAGCCTCCCGGGTGGCTGG + Intergenic
1192920309 X:75698952-75698974 ACCTCTGACCCCCGGGTTCAAGG - Intergenic
1198872874 X:141194174-141194196 ACAGCAGCCACCGGGGTGGAGGG + Intergenic
1200788347 Y:7278176-7278198 ACCTCAGACTCCCTGGTTGAAGG - Intergenic
1201904199 Y:19073225-19073247 ACCTCAGACTCCTGGGTGGCTGG - Intergenic