ID: 1067082791

View in Genome Browser
Species Human (GRCh38)
Location 10:43221114-43221136
Sequence GACCGCAGACCCCCGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082791_1067082797 -1 Left 1067082791 10:43221114-43221136 CCTCCACCCGGGGGTCTGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082791_1067082800 7 Left 1067082791 10:43221114-43221136 CCTCCACCCGGGGGTCTGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data
1067082791_1067082799 6 Left 1067082791 10:43221114-43221136 CCTCCACCCGGGGGTCTGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data
1067082791_1067082801 21 Left 1067082791 10:43221114-43221136 CCTCCACCCGGGGGTCTGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082791_1067082795 -8 Left 1067082791 10:43221114-43221136 CCTCCACCCGGGGGTCTGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1067082795 10:43221129-43221151 CTGCGGTCCCTCTGCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082791 Original CRISPR GACCGCAGACCCCCGGGTGG AGG (reversed) Intronic
900113869 1:1020493-1020515 GACCGCCAAGCCCCGGGAGGGGG + Intronic
900403812 1:2483791-2483813 GGGCGCTGACCCCCGTGTGGGGG + Intronic
900432355 1:2608316-2608338 GCCTGCAGACCCCCAAGTGGAGG + Intronic
903190267 1:21652135-21652157 GGCCGCAGACCCTCTGTTGGAGG + Intronic
904236563 1:29121113-29121135 GTCCGTGGACCCCAGGGTGGGGG + Exonic
908605304 1:65792242-65792264 GGACGCAGACCCCCGGGTTGGGG - Intergenic
912486676 1:110034728-110034750 GCCCGCGGTGCCCCGGGTGGTGG - Exonic
922464736 1:225839108-225839130 GCCCGCCTACCCCCAGGTGGAGG - Intronic
924853882 1:247857221-247857243 GAGCGCAGCCCTCCGGGAGGCGG + Exonic
1064022760 10:11823197-11823219 GACCGAGGACCCCCGGGAGGCGG + Intergenic
1067082791 10:43221114-43221136 GACCGCAGACCCCCGGGTGGAGG - Intronic
1071086578 10:81874380-81874402 GAACGCAGACCCCGGGCTGAGGG - Intergenic
1072938011 10:99732077-99732099 GACCACAGAGCCCTGGGTTGTGG - Exonic
1076691509 10:132225937-132225959 GACCTCACACCCCTGCGTGGGGG + Intronic
1076992832 11:284627-284649 GCCTGCAGACCCTCAGGTGGAGG + Exonic
1077065738 11:640226-640248 CACCGCAGACCCGCAGGAGGCGG + Exonic
1077112428 11:867758-867780 GACAGCAGGCCCCAGGGTAGGGG - Intergenic
1077119341 11:899647-899669 GCCCCCAGACCCCCGGGGTGGGG - Intronic
1077330018 11:1980095-1980117 GACCTCTGATCCCCGGCTGGAGG + Intronic
1077480346 11:2811687-2811709 GTCAGCAGACCCCTGGCTGGAGG + Intronic
1083180548 11:60982099-60982121 GACAGCAGATGCCCGGGTGGGGG + Intronic
1083943878 11:65913203-65913225 AACCCCAGACCCCAGGGAGGAGG - Intergenic
1202812995 11_KI270721v1_random:35274-35296 GACCTCTGATCCCCGGCTGGAGG + Intergenic
1096475497 12:51906966-51906988 GACCGAGGACCCCCGGGCTGAGG + Intronic
1097173463 12:57129579-57129601 GACCCCAGAGCCCCGGCTGGAGG + Intronic
1104069143 12:125329515-125329537 GACCCCAGACCCAAGGGTGGAGG - Intronic
1104638451 12:130452172-130452194 GACCGAGGACCCCAGGGAGGGGG - Intronic
1104944178 12:132408292-132408314 GACCAGAGACCCCTGTGTGGGGG + Intergenic
1106597946 13:31162306-31162328 GACCCCAGACACCGGGATGGTGG + Intronic
1112091909 13:96091144-96091166 GCCCGGAGACCCCCGGGAGGGGG + Exonic
1117119519 14:52552933-52552955 GAGCCGAGACCCCCGGGGGGTGG + Intergenic
1117813774 14:59576653-59576675 GACCGAGGAGCCCAGGGTGGAGG + Exonic
1118563018 14:67107637-67107659 GACCCTAGACCCCTGGATGGTGG + Intronic
1118584080 14:67335369-67335391 GACTGGAGACCCCAGTGTGGGGG + Exonic
1121993935 14:98587089-98587111 GACCTCAGACCCCCCAGTTGAGG + Intergenic
1125804949 15:42485886-42485908 GACCACAGTCCCACTGGTGGTGG - Intronic
1126407128 15:48332361-48332383 GCGCGCGGAGCCCCGGGTGGGGG - Exonic
1129775330 15:78233039-78233061 GCCCACAGACCCCAGGGAGGAGG + Intronic
1129788548 15:78325065-78325087 GTGCGCAGACCCCTGGGTGTTGG - Intergenic
1130882034 15:88063513-88063535 GATCGCAGAGCCCTGGCTGGTGG + Intronic
1131446683 15:92504104-92504126 GACTGCAGATCCCAGGGAGGAGG + Intergenic
1132252652 15:100345833-100345855 GAGCCCAGAGCCCAGGGTGGGGG - Intergenic
1132404714 15:101535419-101535441 GACCACAGGGCCCAGGGTGGTGG + Intergenic
1134615745 16:15650188-15650210 GACCGCAGGCTCCGGGGCGGGGG + Intronic
1136292798 16:29285788-29285810 GACCCCTGACCCTGGGGTGGGGG + Intergenic
1140218704 16:73028294-73028316 GACCTCAGTCCACCGGGAGGTGG + Intronic
1140414958 16:74767948-74767970 GAGCACTGACCACCGGGTGGAGG + Intronic
1141178750 16:81738272-81738294 GTCCCCAGACCCCCGGGAGTGGG - Intergenic
1142098687 16:88259792-88259814 GACCCCTGACCCTGGGGTGGGGG + Intergenic
1143691612 17:8571820-8571842 GACTGCTGACCCCGGGGGGGTGG - Intronic
1145037502 17:19551551-19551573 GACCAGGGACCCCAGGGTGGAGG + Intronic
1148899803 17:50866841-50866863 GGCCGCAGACCCCCGCGGAGAGG - Intronic
1151626250 17:75277708-75277730 GGCCGCAGTCCCCCAGCTGGAGG + Intronic
1152424204 17:80210222-80210244 GACGGCAGTGCCCCTGGTGGTGG + Exonic
1152923931 17:83079243-83079265 CCCCGCAGACCCCCGCGAGGCGG - Intergenic
1154270116 18:12911621-12911643 GCCAGCGGACCCCGGGGTGGCGG + Intronic
1157279029 18:46333942-46333964 GACCGCGGGCGCGCGGGTGGCGG - Intronic
1157545031 18:48540744-48540766 GACCGCAGACCGCGGCGTAGTGG + Intronic
1158441232 18:57476079-57476101 GACTCCAGACGCCAGGGTGGGGG - Intronic
1161442169 19:4298145-4298167 GCCCGCAGACCCCCAGGCTGAGG + Exonic
1161850875 19:6737427-6737449 GACCCCAGACCCTCGCGCGGCGG + Intronic
1162087234 19:8256169-8256191 GACCGCAGACCCAGGGTGGGAGG + Intronic
1162345103 19:10114192-10114214 GACAGCAGACCACGGGCTGGCGG + Exonic
1163633680 19:18429070-18429092 GACCGCAGGGCCCAGGGCGGAGG + Intronic
1164834732 19:31349777-31349799 GACCGCCGAGCCCCGGGCCGCGG - Intergenic
1165179293 19:33954042-33954064 GAGGGCAGAGCCCCAGGTGGTGG - Intergenic
1165419950 19:35717783-35717805 GAGCACAGACCCCCGCGTCGCGG - Intergenic
1166165408 19:40984316-40984338 GACCTCAGGCCCCTGCGTGGTGG - Intergenic
1167455490 19:49595323-49595345 GCCTGCAGCCCCCTGGGTGGTGG + Exonic
926423184 2:12718090-12718112 GACCGAGGACCCCCGGGAGCCGG + Exonic
933763524 2:85692127-85692149 GACCCCAGAGGCCTGGGTGGAGG + Intronic
936611431 2:114005567-114005589 CCCCGGAAACCCCCGGGTGGTGG - Intergenic
937279516 2:120707759-120707781 GACCGCAGACCCAGGGGTCATGG - Intergenic
948778676 2:240303726-240303748 GCCTGCAGACCCACGAGTGGGGG + Intergenic
948908206 2:240989844-240989866 GACCCCAGCCCCCTGGGTGAGGG + Intronic
1169207971 20:3750503-3750525 GCCCGCAGGGCCCGGGGTGGGGG - Intronic
1170646657 20:18202855-18202877 GTCCTCAGGCCCCCAGGTGGTGG + Intergenic
1176068833 20:63215772-63215794 GAACGCAGAGCCCGGGGTCGCGG - Intronic
1176286176 21:5020663-5020685 CTCCGCAGTCCCGCGGGTGGAGG + Intergenic
1179344341 21:40542944-40542966 CACCGCAGAGGCCCGGGTGAGGG - Intronic
1179824717 21:43957525-43957547 AACCCGAGACCCCCGTGTGGAGG - Intronic
1179824728 21:43957552-43957574 AACCCGAGACCCCCGTGTGGAGG - Intronic
1179824747 21:43957598-43957620 AACCCGAGACCCCCGCGTGGAGG - Intronic
1179824766 21:43957652-43957674 AACCCGAGACCCCCGTGTGGAGG - Intronic
1179824788 21:43957706-43957728 AACCAGAGACCCCCGTGTGGAGG - Intronic
1179824806 21:43957751-43957773 AACCCGAGACCCCCGTGTGGAGG - Intronic
1179871005 21:44242812-44242834 CTCCGCAGTCCCGCGGGTGGAGG - Intergenic
1180260914 21:46668048-46668070 GGGCGCAGACCTCCGGCTGGAGG - Intergenic
1182472061 22:30554832-30554854 CACCTCAGACCCCGGGGTGAGGG - Exonic
1183716135 22:39534794-39534816 GCCCACGGTCCCCCGGGTGGAGG + Intergenic
1185147531 22:49147360-49147382 GGCCGCAGAGCCCCGGGCCGGGG - Intergenic
1185413373 22:50697394-50697416 CGCCGCCGACCCCCGGGAGGGGG - Intergenic
953484700 3:43285005-43285027 GACTACAGACCCAGGGGTGGAGG + Intergenic
954300691 3:49699377-49699399 GAGCCCAGGCCCCGGGGTGGGGG + Intronic
956840490 3:73135462-73135484 GACCCCAAACCCCCATGTGGAGG + Intergenic
960848022 3:122022321-122022343 GGCCGCAGTCCCCCGGGAGGCGG - Intergenic
961674351 3:128555662-128555684 GACTCCAAGCCCCCGGGTGGGGG + Intergenic
963257507 3:143160492-143160514 GACCGAAGTCCCCCGGGGAGAGG - Intergenic
967847904 3:194058515-194058537 GTCCGCACAAGCCCGGGTGGCGG + Intergenic
974009255 4:56592572-56592594 GGCCTCGGTCCCCCGGGTGGCGG - Intronic
982222961 4:153140603-153140625 GACCTCAGTCCCCCGGGATGCGG + Intergenic
999834213 5:155352210-155352232 GAATGCAGACCCCAGGCTGGAGG + Intergenic
1006039632 6:31243845-31243867 GGGGGCTGACCCCCGGGTGGTGG - Intergenic
1010903703 6:81458983-81459005 GACCACAGACCTCTGGGGGGTGG + Intergenic
1019436160 7:1023303-1023325 TTCCGCAGACCCCGCGGTGGCGG - Intronic
1019637071 7:2081657-2081679 GACGGCGGACCCCTGTGTGGAGG - Intronic
1022098743 7:27156877-27156899 GTCCGCAGACCCCAGTGCGGAGG - Intronic
1022923407 7:35037653-35037675 GACCGCGGAACGCCGGGGGGCGG + Intronic
1025739440 7:64183588-64183610 TCCCGCAGACCCCGGGGTGATGG + Intronic
1026938486 7:74272785-74272807 GGCCGCAGACCTCAGGGTTGGGG + Intergenic
1026968607 7:74454743-74454765 GGCCGCTGAATCCCGGGTGGAGG + Intronic
1032011704 7:128351677-128351699 GACTGCAGAGCGCCGGGTAGAGG + Exonic
1034392905 7:150800376-150800398 GACGGCAGATGCACGGGTGGGGG + Intronic
1034911454 7:155002328-155002350 GACGGCAGCTGCCCGGGTGGCGG + Intronic
1035356404 7:158278261-158278283 GACCTCTGACCCCAGGGAGGAGG + Intronic
1035371069 7:158379229-158379251 GGCTGCGGACCCCAGGGTGGGGG + Intronic
1035620377 8:1032245-1032267 CACAGCAGAGCCACGGGTGGTGG - Intergenic
1035729552 8:1844526-1844548 CACCGCAGACCCCCGGCAGCAGG - Intronic
1039792067 8:40884080-40884102 GACCTCAGTCCAGCGGGTGGTGG - Intronic
1041201069 8:55452341-55452363 GCTCACAGACCCCCTGGTGGGGG - Intronic
1042183302 8:66113153-66113175 GACCCCAGACACCTGGGTTGAGG + Intergenic
1045112308 8:98947502-98947524 GAGGGCAGACCCCCAGGTGTAGG - Intronic
1048953628 8:139516038-139516060 GGCTGCAGGCCCCCAGGTGGTGG + Intergenic
1049611587 8:143558506-143558528 GGCCGCTGGCTCCCGGGTGGGGG + Intronic
1049694399 8:143976454-143976476 GACCGCAGGGCTCCGGGCGGGGG - Intronic
1050537828 9:6645563-6645585 GGCCTCGGTCCCCCGGGTGGCGG + Exonic
1051418932 9:16871295-16871317 GCCCGCAGCTCCCCGGGGGGGGG - Intergenic
1057547233 9:96027529-96027551 AACCGAAGGCCCCCGCGTGGAGG + Intergenic
1060547781 9:124470988-124471010 GGCCGCAGACCCCAAGGGGGAGG - Intronic
1060553256 9:124495579-124495601 CACCGTAGACACCCAGGTGGTGG + Intronic
1185534319 X:848615-848637 GACTCCAGAGCCCCGGGTAGTGG + Intergenic
1198872873 X:141194173-141194195 GACAGCAGCCACCGGGGTGGAGG + Intergenic
1200094141 X:153649438-153649460 GCCCGCAGCCCCACTGGTGGGGG - Exonic