ID: 1067082792

View in Genome Browser
Species Human (GRCh38)
Location 10:43221117-43221139
Sequence AGGGACCGCAGACCCCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082792_1067082801 18 Left 1067082792 10:43221117-43221139 CCACCCGGGGGTCTGCGGTCCCT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082792_1067082799 3 Left 1067082792 10:43221117-43221139 CCACCCGGGGGTCTGCGGTCCCT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data
1067082792_1067082797 -4 Left 1067082792 10:43221117-43221139 CCACCCGGGGGTCTGCGGTCCCT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082792_1067082800 4 Left 1067082792 10:43221117-43221139 CCACCCGGGGGTCTGCGGTCCCT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082792 Original CRISPR AGGGACCGCAGACCCCCGGG TGG (reversed) Intronic
902877863 1:19351837-19351859 AGGGACCGGAGATCCCTGGCAGG - Intronic
902881619 1:19375372-19375394 AGGGACCGCAGACCACCAAAGGG - Intronic
907430178 1:54406771-54406793 AGGGGGCGCAGACCCCCAAGCGG + Intronic
913592286 1:120341256-120341278 CGGCGCCGAAGACCCCCGGGGGG - Intergenic
920557181 1:206912755-206912777 ATGGACCGCAGATCTCAGGGAGG + Intronic
922501533 1:226100461-226100483 AGCGACCCCAGACTCCCGAGTGG + Intergenic
922602945 1:226870778-226870800 AGGGGCCGCAGACCCACAGCCGG - Intronic
922721679 1:227903083-227903105 AGGCACTGCAAACCCCAGGGTGG + Intergenic
922928803 1:229373068-229373090 AGGGATCACAGAACCCTGGGTGG - Intergenic
924853881 1:247857218-247857240 CGGGAGCGCAGCCCTCCGGGAGG + Exonic
1067082792 10:43221117-43221139 AGGGACCGCAGACCCCCGGGTGG - Intronic
1069903298 10:71718247-71718269 AGGGACAGGAGTCCCTCGGGTGG - Intronic
1070724929 10:78781397-78781419 ATGGAGCGCAGGCCCCCGCGAGG + Intergenic
1070789826 10:79182386-79182408 GGTGACTGCAGACCCCCGAGAGG + Intronic
1070808073 10:79282474-79282496 AGGGACGGCAGACGCCTGGAGGG + Intronic
1073532921 10:104249230-104249252 TGAGACCGTAAACCCCCGGGAGG + Intronic
1075732750 10:124646027-124646049 AGGGACTGCAGACACCAGGGAGG + Intronic
1076290968 10:129344898-129344920 AGGGACCACAGTGCTCCGGGGGG + Intergenic
1076754938 10:132564466-132564488 AGGGGCCGCACAGCCCAGGGAGG - Intronic
1077338414 11:2015593-2015615 AGGGACAGCAGACAGCAGGGAGG - Intergenic
1077480345 11:2811684-2811706 AGGGTCAGCAGACCCCTGGCTGG + Intronic
1078884857 11:15490056-15490078 AGGGCCAGCAGACACCCAGGAGG - Intergenic
1083180545 11:60982096-60982118 GGGGACAGCAGATGCCCGGGTGG + Intronic
1083233368 11:61337019-61337041 AGGGGCCGCAGCCTCCCGAGGGG - Intronic
1088754769 11:112876634-112876656 AGGGTCCCCAGACTCCCTGGTGG + Intergenic
1202821398 11_KI270721v1_random:70775-70797 AGGGACAGCAGACAGCAGGGAGG - Intergenic
1096796573 12:54081754-54081776 AGGGACTGCAGACCCGGGTGCGG + Intergenic
1097690321 12:62728760-62728782 AGGGAACTCAGACCCCAGGGAGG + Intronic
1101371664 12:104137391-104137413 AGGGACCGCAAACCGCCAGATGG + Intronic
1102236911 12:111299223-111299245 CGGGCCCGCAGACCTCAGGGCGG - Intronic
1102482960 12:113236495-113236517 AGGGACCGAACATCCCAGGGAGG + Intronic
1103844417 12:123891599-123891621 AGGGCAGGCAGAGCCCCGGGAGG + Intronic
1103856000 12:123972214-123972236 AGGGCCGGCAGACCCCGCGGGGG + Intronic
1104638454 12:130452175-130452197 AGGGACCGAGGACCCCAGGGAGG - Intronic
1105426877 13:20301918-20301940 TAGGACCGCAGACCCTCTGGTGG + Intergenic
1105512401 13:21061452-21061474 AGGGACGGGGGAGCCCCGGGCGG + Exonic
1105823369 13:24099602-24099624 AGGGCCCACAGCCCCCCGGGTGG + Intronic
1110684548 13:78356648-78356670 AGGGGCCGTAGACCCTCAGGTGG + Intergenic
1112091906 13:96091141-96091163 GGAGCCCGGAGACCCCCGGGAGG + Exonic
1113627357 13:111856845-111856867 TGGCACCACAGACCCCCGGAAGG - Intergenic
1121636408 14:95456722-95456744 ATGGCCCACAGACCCCCGTGAGG - Intronic
1122276051 14:100591337-100591359 AAGGAGCCCAGACCCCCAGGTGG - Intergenic
1127008389 15:54595454-54595476 AGGAACCACAGACCCCCTGAAGG - Intronic
1128388153 15:67165157-67165179 GTGCACCGCAGACCCTCGGGGGG - Intronic
1131269008 15:90935342-90935364 AGGGACCCCCGAGCCCCGGCCGG + Exonic
1132627892 16:900916-900938 AGGCATCGCAGGCCCACGGGAGG - Intronic
1132932897 16:2467881-2467903 AGGGCGCGCAGGGCCCCGGGGGG - Intergenic
1134242603 16:12517130-12517152 AGTGACAGCAGAGCCACGGGTGG + Intronic
1136006179 16:27330885-27330907 AGGGGCCACAGATCCCCAGGGGG - Intronic
1137787931 16:51152466-51152488 TGGCGCCGCAGAGCCCCGGGCGG + Intergenic
1143575740 17:7792168-7792190 ACGGGCCCCAGACCACCGGGTGG - Intronic
1143590944 17:7885510-7885532 AGGGACCGCCGAGACCCTGGCGG + Intronic
1143628982 17:8126457-8126479 TGGGAGCGCAGAGTCCCGGGAGG - Intergenic
1144564506 17:16348854-16348876 AGGTACAGCAGAGCCCAGGGGGG + Intronic
1146167899 17:30605134-30605156 AGAGAACACAGACCCCCAGGAGG - Intergenic
1146220868 17:31018651-31018673 AGAGAACACAGACCCCCAGGAGG - Intergenic
1152046916 17:77942828-77942850 AAGGACAGCACACCCCAGGGTGG - Intergenic
1152785168 17:82244008-82244030 AGGGACCGCAGGCTGCCGCGGGG - Exonic
1154213635 18:12399870-12399892 AGGGACCACAGGCCTCTGGGTGG + Intergenic
1154389481 18:13924118-13924140 AGGAAACTGAGACCCCCGGGAGG + Intergenic
1154529672 18:15330993-15331015 AGGAAGAGCAGAGCCCCGGGTGG - Intergenic
1157802017 18:50628376-50628398 AGGGAACCCAGGCCCCAGGGAGG - Intronic
1159144991 18:64442606-64442628 ATTGAACGCAGACCCCAGGGAGG - Intergenic
1160865455 19:1254042-1254064 AGGGACCCCAGAGCCCAGAGAGG + Intronic
1162087233 19:8256166-8256188 AGAGACCGCAGACCCAGGGTGGG + Intronic
1162926574 19:13933237-13933259 AGCGGCCGCAGAGCCCCGGCGGG + Exonic
1164578091 19:29417804-29417826 AGGGACCGCACCCCCTGGGGAGG - Intergenic
1167125517 19:47545759-47545781 AGGGACCGCAGGCTGCTGGGGGG + Exonic
1167609020 19:50497304-50497326 AGGGACCGCAGAGGCCCCGGAGG + Intergenic
1168037024 19:53728017-53728039 AGCCACCGCAGATCCCGGGGTGG + Intergenic
1168307766 19:55444716-55444738 AGTCACCCCAGACCCCTGGGGGG - Intergenic
925331378 2:3061429-3061451 AGGGACCACAGACCCACCTGAGG + Intergenic
931762699 2:65431684-65431706 AGGGAGCGGAGACCGCCGGGAGG + Intronic
933847544 2:86337707-86337729 CGGGCCCGCCGAGCCCCGGGGGG - Intronic
934771124 2:96908135-96908157 TGGGCTTGCAGACCCCCGGGAGG - Intronic
936539294 2:113337039-113337061 AGGCACCGGTGACCCCCTGGGGG + Intergenic
938528765 2:132162433-132162455 AGGAAGAGCAGAGCCCCGGGTGG - Intronic
947719889 2:232363840-232363862 AGAAACCGCAGGGCCCCGGGAGG - Intergenic
947731457 2:232433705-232433727 GGGAACCGCAGGGCCCCGGGAGG - Intergenic
947860688 2:233355052-233355074 GGGGACCGCGGACGCCCGCGGGG - Intronic
948487394 2:238289383-238289405 AGGCACCTCAGAGGCCCGGGTGG - Intronic
948645165 2:239400246-239400268 CGGGGCCGCGGACCCCCGGCAGG + Intronic
1169216897 20:3799383-3799405 GGGCACAGCAGCCCCCCGGGGGG + Intronic
1171848031 20:30289769-30289791 AGGGACTGCAGACCCGGGTGCGG + Intergenic
1172421938 20:34825413-34825435 AAGGACCGCGGACGCCCGGCGGG + Intronic
1175028993 20:55933566-55933588 AGGGCTTGCAGACCCCAGGGAGG - Intergenic
1176150676 20:63589193-63589215 ATGGATCTCAGACCCCTGGGAGG + Exonic
1176371808 21:6066865-6066887 AGGTGCCGCAGACCCCTGGGAGG + Intergenic
1176767738 21:13037479-13037501 AGGAAGAGCAGAGCCCCGGGTGG + Intergenic
1179751711 21:43471674-43471696 AGGTGCCGCAGACCCCTGGGAGG - Intergenic
1180514860 22:16131717-16131739 AGGAAGAGCAGAGCCCCGGGTGG + Intergenic
1182065539 22:27428915-27428937 AAAGACCACAGACCCCTGGGTGG + Intergenic
1182379133 22:29872307-29872329 AGGGACTCCAGTCCCCTGGGTGG + Intergenic
1183376754 22:37469780-37469802 AGGCACCCCAGGCCCCTGGGAGG - Exonic
1184644657 22:45889427-45889449 ATGGACCTCAGACCCCTGGCTGG - Intergenic
1185055944 22:48578356-48578378 GGGGACAGCAGAGCCCCCGGAGG - Intronic
1185225386 22:49648864-49648886 AGGAAATGCAGACTCCCGGGGGG - Intronic
949921724 3:9008376-9008398 AGGGACCTCAGCCCCCAGGAAGG + Intronic
951572357 3:24077945-24077967 AGGGCCCGCAGACCCTCTGAAGG - Intergenic
953484699 3:43285002-43285024 AGGGACTACAGACCCAGGGGTGG + Intergenic
960848023 3:122022324-122022346 GGTGGCCGCAGTCCCCCGGGAGG - Intergenic
967197512 3:187041338-187041360 AGGGACCTCAGACCCCTAGTGGG + Intronic
967939890 3:194757437-194757459 TGGGCCAGCAGACCCCAGGGTGG + Intergenic
968487079 4:867910-867932 AGGCACCGCAGAGGCCCAGGCGG - Intronic
969487656 4:7481305-7481327 AGGGATGGCACAGCCCCGGGAGG + Intronic
969574797 4:8030550-8030572 AGGGACAGCACACCTCGGGGTGG - Intronic
973714499 4:53662011-53662033 ATGGACCCCAGGCCCCCTGGAGG + Intronic
983646166 4:169993651-169993673 AGGAACTGTAGAACCCCGGGAGG - Intronic
984455197 4:179957670-179957692 AGAGACGGCAGGCCCCCGAGAGG - Intergenic
984866367 4:184283963-184283985 AGTGCCCGCAGACACCCGTGGGG - Intergenic
985541110 5:488179-488201 AGGGACGGGACGCCCCCGGGAGG + Intronic
985605154 5:854281-854303 AGGGGCCACAGACCCCACGGAGG + Intronic
998442724 5:142175704-142175726 AGGGAACCCAGACCACCTGGAGG + Intergenic
1002405111 5:179024186-179024208 AGGGTCCGGAGCCCTCCGGGCGG + Intronic
1009798376 6:68502200-68502222 AGGGCCCACAGACCCCCTGAAGG + Intergenic
1015994788 6:138987379-138987401 AGGGGCCGCAGGTGCCCGGGAGG - Intronic
1018892262 6:167990438-167990460 AGGCTCCCCAGAGCCCCGGGGGG - Intergenic
1019299383 7:295799-295821 AGGGCCGCCAGACCCCCGCGCGG - Intergenic
1019547714 7:1586422-1586444 GGGGGCCGCAGTCCCCCGGGGGG - Intergenic
1020120238 7:5499139-5499161 GGGGACCACAGACTCCTGGGAGG - Intronic
1022098060 7:27153005-27153027 TAGGACCGCAGACCCCCGCTAGG - Intergenic
1022105255 7:27192379-27192401 AGTGTCCGCAGACCCGCGGCCGG + Intergenic
1024307093 7:47938178-47938200 AGGGAGCGCACATCCCAGGGAGG - Intronic
1029471817 7:100759475-100759497 AGGGAGCACAGACGCCCTGGAGG + Intronic
1029692411 7:102191071-102191093 AGGGCCAGCAGACGCCAGGGAGG - Intronic
1033059125 7:138088412-138088434 AGGGAGCGGAGGCCCCTGGGAGG + Intronic
1035281109 7:157779075-157779097 AGGGTCCCAAGACCCCAGGGAGG - Intronic
1035356403 7:158278258-158278280 GGGGACCTCTGACCCCAGGGAGG + Intronic
1035371066 7:158379226-158379248 AGGGGCTGCGGACCCCAGGGTGG + Intronic
1035411204 7:158643914-158643936 AGGGACCGCACATCCCCATGTGG + Intronic
1035472452 7:159119171-159119193 ATGGGCCGCAGCTCCCCGGGTGG + Intronic
1047318273 8:123754515-123754537 AGGAACCGCAGAGCCCCAGGAGG + Intergenic
1049532565 8:143161821-143161843 CGGGACCTCAGACCCCGTGGGGG - Intergenic
1053372660 9:37576013-37576035 GGGGACCGCGGAGCCGCGGGCGG + Intronic
1053412278 9:37923448-37923470 CGGGACCTCGGACCCCTGGGGGG - Intronic
1053707380 9:40768762-40768784 AGGAAGAGCAGAGCCCCGGGTGG - Intergenic
1054158880 9:61659780-61659802 AGGGACTGCAGACCCGGGTGCGG - Exonic
1054174885 9:61868363-61868385 AGGGACTGCAGACCCAGGTGCGG + Intergenic
1054417294 9:64889530-64889552 AGGAAGAGCAGAGCCCCGGGTGG - Intergenic
1054478654 9:65590785-65590807 AGGGACTGCAGACCCGGGTGCGG - Intergenic
1054662654 9:67712430-67712452 AGGGACTGCAGACCCAGGTGCGG - Intergenic
1057090682 9:92255329-92255351 AGGAACCGCAGAGCCCTGTGAGG + Intronic
1057483454 9:95463376-95463398 CGGGACAGGAGACCACCGGGTGG + Intronic
1059102211 9:111482873-111482895 AGGGACCGCCGTCCCCGGGAAGG + Intronic
1061859446 9:133460443-133460465 AGGGACCAGAAACCCCAGGGCGG + Intronic
1193490585 X:82143893-82143915 AGGGACCACAGACCCCACGAAGG + Intergenic
1195379040 X:104254246-104254268 AGGGACCACAGCCCCCAGAGAGG - Exonic
1197776252 X:130120580-130120602 AGGCCCCACAGAGCCCCGGGCGG - Intergenic
1200134948 X:153870310-153870332 AGGGAGCTCAGACCACCGCGGGG - Intronic