ID: 1067082793

View in Genome Browser
Species Human (GRCh38)
Location 10:43221120-43221142
Sequence CAGAGGGACCGCAGACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082793_1067082800 1 Left 1067082793 10:43221120-43221142 CCCGGGGGTCTGCGGTCCCTCTG 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data
1067082793_1067082797 -7 Left 1067082793 10:43221120-43221142 CCCGGGGGTCTGCGGTCCCTCTG 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082793_1067082801 15 Left 1067082793 10:43221120-43221142 CCCGGGGGTCTGCGGTCCCTCTG 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082793_1067082799 0 Left 1067082793 10:43221120-43221142 CCCGGGGGTCTGCGGTCCCTCTG 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082793 Original CRISPR CAGAGGGACCGCAGACCCCC GGG (reversed) Intronic
900641472 1:3689870-3689892 CAGAGGGGCCCGAGTCCCCCTGG - Intronic
900881307 1:5383171-5383193 CAGAGAGACCGCAGAGCCACAGG + Intergenic
900987642 1:6082496-6082518 CAGAGGGACTGTGGTCCCCCTGG - Intronic
900987643 1:6082497-6082519 CAGGGGGACCACAGTCCCTCTGG + Intronic
902808187 1:18873666-18873688 CAGGGGCACCGCCGTCCCCCTGG - Intronic
905241569 1:36584779-36584801 CAGAGGGACAGCAGGCCACTCGG - Intergenic
907516659 1:54997263-54997285 CAGAGGGACCTCAGCCCGTCTGG - Intergenic
907518073 1:55006017-55006039 CAGTGGGACCACCAACCCCCTGG + Intronic
908605307 1:65792248-65792270 CGCAGGGGACGCAGACCCCCGGG - Intergenic
909784512 1:79594101-79594123 CAGTGAGACCGCAAACCCACCGG + Intergenic
910747652 1:90591016-90591038 CAGAGGTCCCGCAGGTCCCCAGG - Intergenic
916656060 1:166876248-166876270 CAGCCCGACCGCAGACCGCCCGG + Exonic
917963959 1:180166884-180166906 CAAAGGGACCCCAGACACTCTGG + Intronic
924451744 1:244184861-244184883 CAGAGGGATCTCACTCCCCCCGG - Intergenic
924730937 1:246711062-246711084 CAGTGAGACCACAGACCCACTGG + Intergenic
1064119350 10:12605680-12605702 CAGTGGCACCGCAGCCCCCAGGG - Intronic
1067082793 10:43221120-43221142 CAGAGGGACCGCAGACCCCCGGG - Intronic
1069526200 10:69174224-69174246 CAGCGAGACCGCAAACCCACTGG + Intergenic
1073532920 10:104249227-104249249 CAGTGAGACCGTAAACCCCCGGG + Intronic
1073578799 10:104645280-104645302 CAGAGGGAGCCCAGTCCCCGTGG + Intronic
1076067335 10:127459065-127459087 CAGCGAGACCGCAAACCCACGGG - Intergenic
1076462100 10:130654736-130654758 CACAGGGGCCGCAGATCCGCGGG + Intergenic
1077066646 11:644018-644040 CAGAAGGAACGAAGACCTCCTGG + Intergenic
1077111987 11:866008-866030 CAGGGAGCCCGCAGGCCCCCAGG - Intronic
1077119345 11:899653-899675 CAGGGAGCCCCCAGACCCCCGGG - Intronic
1077285468 11:1763504-1763526 CAGACTGACCGCAGCCTCCCTGG - Intronic
1079056006 11:17207523-17207545 CAGAAGGAGGGCAGGCCCCCCGG - Intronic
1080647210 11:34195913-34195935 CAAGGGGACTGCAGAGCCCCTGG + Intronic
1084501830 11:69539761-69539783 CTGAGGGCCCGAAGCCCCCCTGG + Intergenic
1084516997 11:69642710-69642732 CAGAGGGACCACGGAGCTCCAGG + Intronic
1084575552 11:69986015-69986037 CAGAGCCGCCGCAGACCTCCAGG + Intergenic
1089806682 11:121097010-121097032 TACAGGGTCTGCAGACCCCCTGG - Intergenic
1090563319 11:127957966-127957988 CAGTGAGACTTCAGACCCCCAGG - Intergenic
1091773894 12:3171887-3171909 CAGAGTGGCCGCAGTCCCCAGGG + Intronic
1092285972 12:7129552-7129574 CAGAGGGAGAGAAAACCCCCTGG - Intergenic
1093484752 12:19640875-19640897 TGGAGGGAGCGCGGACCCCCGGG - Intronic
1094110657 12:26858787-26858809 CAGAGGGAACGCAGCCCTGCTGG + Intergenic
1101298752 12:103455610-103455632 AAGAGGAACCTCACACCCCCAGG - Intronic
1104638455 12:130452178-130452200 CAGAGGGACCGAGGACCCCAGGG - Intronic
1105019192 12:132805162-132805184 CAGAGGACCCCAAGACCCCCAGG + Intronic
1105019355 12:132805618-132805640 CAGAGGACCCCGAGACCCCCAGG + Intronic
1105913554 13:24892741-24892763 CAGAGAGAACACAGACCTCCGGG - Exonic
1107343092 13:39431039-39431061 CAGAGAGACCACAAACCCACTGG + Intronic
1110565578 13:76954713-76954735 CAGAGGGAGCTCAGGCCACCAGG + Intronic
1113115413 13:106869799-106869821 CAGAGGTAGCACAGACCCACAGG + Intergenic
1113831133 13:113296889-113296911 CAGACGGATCGCGGACGCCCAGG - Intergenic
1113906942 13:113823726-113823748 CAGAGGCACCGGGGACCCCCAGG + Intronic
1116984284 14:51203385-51203407 CAGAGGAACAGCAGGTCCCCAGG - Intergenic
1118326966 14:64787802-64787824 CAGACTGACCCCAGGCCCCCAGG - Intronic
1119421508 14:74510318-74510340 CAGAGGGGCCGCAGGCCACCTGG + Intronic
1119701844 14:76761260-76761282 CAGAGGGAGCGCAAACTCCATGG - Intergenic
1121610351 14:95274470-95274492 CAGAGGGACCACAGCTCTCCAGG - Intronic
1122276052 14:100591340-100591362 CTGAAGGAGCCCAGACCCCCAGG - Intergenic
1122901347 14:104783565-104783587 CAGAGTGGGCACAGACCCCCAGG + Intronic
1123825638 15:24078919-24078941 CAGAGTGGACGCAGAGCCCCAGG + Intergenic
1124031644 15:26017627-26017649 CAGCGGGACCACAAACCCACTGG - Intergenic
1126034826 15:44536681-44536703 CAGAGGGACAGCGCACCCTCCGG + Intergenic
1128889594 15:71318761-71318783 CAGAAGGAGCACAGACACCCAGG + Intronic
1129903892 15:79172607-79172629 CACAGGGACCTCAGATTCCCAGG + Intergenic
1131999492 15:98164416-98164438 GAGAGGAACAGCAGATCCCCAGG + Intergenic
1132627893 16:900919-900941 CAGAGGCATCGCAGGCCCACGGG - Intronic
1134008318 16:10833187-10833209 CAGAGGGACTGAGGAGCCCCTGG + Intergenic
1134111488 16:11517946-11517968 GAGAGTGACCGCTGCCCCCCTGG - Intronic
1134242602 16:12517127-12517149 CAGAGTGACAGCAGAGCCACGGG + Intronic
1135034746 16:19067713-19067735 GAGAGGGACCGCCGGGCCCCCGG - Exonic
1136006182 16:27330888-27330910 CACAGGGGCCACAGATCCCCAGG - Intronic
1136550196 16:30979010-30979032 CGGAGGGAACACAGACGCCCTGG - Intronic
1138490000 16:57371274-57371296 CAGAGGGGCCACAGATCCCAAGG - Intergenic
1141048111 16:80735595-80735617 CAGAGGCAGCCCAGACCCCCAGG + Intronic
1143185706 17:5008747-5008769 CAGAAGGACCCCAAAGCCCCAGG - Intronic
1144638046 17:16923516-16923538 CAGAGGCACCACAGGCTCCCAGG - Intergenic
1145796038 17:27655779-27655801 CTGTGGGACCGCCGACCCCTGGG - Intergenic
1148215288 17:45830775-45830797 CTGAGTAACCCCAGACCCCCTGG + Intronic
1151101376 17:71559384-71559406 CAGATGGACCAAAGAGCCCCAGG + Intergenic
1151994986 17:77602884-77602906 AAGTGGGACTGGAGACCCCCTGG - Intergenic
1153293126 18:3520907-3520929 CAGAGGAAACTCAGATCCCCTGG + Intronic
1154111073 18:11568775-11568797 CAGAGAGCCCGCAGCTCCCCTGG - Intergenic
1154306436 18:13234112-13234134 CAGAGGCCCCGCAGAAACCCAGG - Intronic
1158643183 18:59220321-59220343 CAGCGGGACCGCTCGCCCCCGGG - Exonic
1159065532 18:63564641-63564663 CAGAGGGACAGCACAACCCCAGG - Intronic
1159163297 18:64671805-64671827 CAGCGAGACCGCAAACCCACTGG + Intergenic
1160499431 18:79394830-79394852 CAGGAGGTCCGCAGACCCCCAGG - Intergenic
1161442168 19:4298139-4298161 CCTGGGGCCCGCAGACCCCCAGG + Exonic
1162372319 19:10287011-10287033 CAGAGGGAACAGAGACCCCATGG - Exonic
1163156537 19:15442769-15442791 CAGGGGGACCCCAGCCCCTCAGG - Intronic
1163291720 19:16383607-16383629 CAGAGGGAGCCCAGAGGCCCTGG - Intronic
1164422454 19:28106666-28106688 CAGAGCGACTGCATCCCCCCAGG + Intergenic
1165955424 19:39499249-39499271 CAGGGGGACCGCGGGGCCCCAGG - Exonic
1167079044 19:47266728-47266750 CAGAGGCACCGCAAGCCCACTGG + Exonic
1168269555 19:55242103-55242125 CTGAGGGGCCGGAGAGCCCCTGG + Intronic
925278982 2:2669860-2669882 CAGAGGGAGAGCAGGACCCCTGG + Intergenic
925817392 2:7767256-7767278 CTGAGGAACCGCAGACCCCTAGG + Intergenic
926052077 2:9751770-9751792 CAGAGGGACCGTGGCCCCCAGGG + Intergenic
931762698 2:65431681-65431703 GAGAGGGAGCGGAGACCGCCGGG + Intronic
932719794 2:74130728-74130750 CTGAGGGACCGCAGACTCGTCGG + Exonic
933581122 2:84128211-84128233 CAGCGAGACCACAGACCCACTGG + Intergenic
933902777 2:86861608-86861630 CCGGGGGACCGGAGAGCCCCTGG - Intronic
936047001 2:109196066-109196088 CAGAGGGAACGCAGACCACCTGG + Intronic
937237369 2:120438842-120438864 CAGAGGGAACGCAGGTCTCCAGG - Intergenic
944572436 2:201058238-201058260 CATAGCGTCCACAGACCCCCAGG + Intronic
946657254 2:221961773-221961795 CAGGGGCACCGCAGCCTCCCCGG + Intergenic
948802337 2:240438556-240438578 CAGAGGGAATGCGAACCCCCTGG + Intronic
948944982 2:241214940-241214962 CCGAGGGACCCCAGAGCACCTGG + Intronic
949073369 2:242040053-242040075 CAGAGGGGCCCCAGACACCTGGG + Intergenic
1172808071 20:37627397-37627419 GAGAGGGACGGGAGGCCCCCAGG - Intergenic
1174518656 20:51113140-51113162 CAGCAGGGCCGCAGTCCCCCTGG + Intergenic
1175028994 20:55933569-55933591 CAGAGGGCTTGCAGACCCCAGGG - Intergenic
1175919887 20:62445891-62445913 CAGTGTGAACACAGACCCCCGGG - Intergenic
1175957336 20:62618136-62618158 CAGCGGGACAGCAGACCCTGAGG + Intergenic
1176371807 21:6066862-6066884 CACAGGTGCCGCAGACCCCTGGG + Intergenic
1179496984 21:41778242-41778264 CAGAGGCCCCGCTGGCCCCCTGG - Intergenic
1179751712 21:43471677-43471699 CACAGGTGCCGCAGACCCCTGGG - Intergenic
1179797619 21:43794539-43794561 CAGAGGACACGCGGACCCCCAGG - Intronic
1179984983 21:44915379-44915401 CAGAGGCCCCGCAGACCCATTGG + Intronic
1180844339 22:18973159-18973181 CAGGGGTTCCACAGACCCCCAGG - Intergenic
1181027700 22:20135333-20135355 CAGAGGGTTCGAAGACCCCTAGG + Intronic
1181057132 22:20265552-20265574 CAGGGGTTCCACAGACCCCCAGG + Intronic
1183739773 22:39663121-39663143 CAGAGGGAACCCTGATCCCCAGG - Intronic
1184407510 22:44308438-44308460 CAGAGGCACCACAGACCCAGAGG - Intronic
1184981609 22:48099605-48099627 CAGTGGTACCCCAGACCCACAGG - Intergenic
1185055945 22:48578359-48578381 CAGGGGGACAGCAGAGCCCCCGG - Intronic
1185271962 22:49933947-49933969 CCGGGGCACAGCAGACCCCCGGG + Intergenic
953875940 3:46666984-46667006 CAGAGGGACGGCTGACCACTGGG - Intergenic
960619293 3:119623472-119623494 CAGAGGGACAGCAGGTCCCAGGG + Intronic
967886452 3:194336820-194336842 CAGATGTACAGCAGGCCCCCAGG + Intergenic
968289221 3:197525834-197525856 CAGAGGGAGCACAGAAACCCTGG - Intronic
968487080 4:867913-867935 CTGAGGCACCGCAGAGGCCCAGG - Intronic
968705939 4:2077522-2077544 CAGAGGGGCGACAGAGCCCCAGG + Intronic
968911708 4:3479752-3479774 CAGAGAGACCTCTGCCCCCCAGG - Intronic
969134656 4:5020141-5020163 CCGAGGGAGAGCAGACCCTCAGG + Intergenic
969414669 4:7050590-7050612 CCGAGGGACAGCAGAGCCGCAGG + Intronic
969664570 4:8549707-8549729 CAGGGAGGCTGCAGACCCCCTGG - Intergenic
972339237 4:38136837-38136859 CAGAGGGAACCCAAACCCCCAGG - Intronic
985523149 5:388554-388576 CAGGGCCACCGCAGACGCCCTGG - Intronic
988841481 5:35087787-35087809 AAGAGGGACAGCAGAGCCCTGGG + Intronic
991257859 5:64634872-64634894 AAGAGAGACCGCAGACATCCGGG - Intergenic
993429384 5:87813562-87813584 CAGAGGGACAACAGAGACCCTGG + Intergenic
1002351220 5:178585089-178585111 CAGCTGGACAGCAGAGCCCCAGG + Intronic
1002529822 5:179837650-179837672 CAGAGGGACCCCAGGCCAGCTGG - Exonic
1003107355 6:3226984-3227006 CACAGGGACTGCAGCCCGCCAGG + Intronic
1003147527 6:3521186-3521208 CAGTGGGACTGCAGACCACGCGG + Intergenic
1005190025 6:23210664-23210686 CAGCGAGACCACAAACCCCCTGG - Intergenic
1005224606 6:23626919-23626941 CAGAGGGACTGCAAACCAACTGG - Intergenic
1006136966 6:31901466-31901488 CAGAGGGACAGCACCTCCCCAGG - Intronic
1010407510 6:75521567-75521589 CAGAGGGGTAACAGACCCCCAGG + Intergenic
1017021567 6:150143713-150143735 AAGGGGGCCCGCAGATCCCCGGG - Intronic
1019354046 7:569821-569843 CAGTGAGCCCGCAGACCCCACGG + Intronic
1020784278 7:12555448-12555470 CAGCGAGACCACAAACCCCCCGG - Intergenic
1022251234 7:28610506-28610528 CAGAGGGACCTAAATCCCCCAGG + Intronic
1024005932 7:45224849-45224871 CAGTGGCTCTGCAGACCCCCAGG + Intergenic
1025956609 7:66187932-66187954 CAGAGGGACCACACTCCTCCAGG - Intergenic
1026477571 7:70750075-70750097 GGGAGGGACCACAGACACCCAGG - Intronic
1026482394 7:70790197-70790219 CAGAGGCCCCGCAGACCCACCGG + Exonic
1027159152 7:75789789-75789811 CAGGGGTACCGCAGATCCCAGGG - Exonic
1028754161 7:94416402-94416424 CAGGGGGAACGCGGTCCCCCAGG + Exonic
1029988310 7:104941093-104941115 CAGAGAGACCACAAACCCACCGG + Intergenic
1033940397 7:146645416-146645438 TAGAGGGTCTGCATACCCCCTGG + Intronic
1034480703 7:151318315-151318337 CAGAGGGACTGCACACCTCTGGG + Intergenic
1035016302 7:155769421-155769443 CTGGGGGACGGCAGCCCCCCTGG - Intronic
1038444857 8:27596267-27596289 CTCAGGGTCCGCAGTCCCCCAGG + Intergenic
1040829885 8:51664756-51664778 CAGTGGGACCGCAGGGCACCTGG - Intronic
1041001544 8:53459776-53459798 CAGAGAGACCACAAACCCACTGG + Intergenic
1042099648 8:65261144-65261166 CAGAGGAACTGCAGAACCCCTGG + Intergenic
1042159507 8:65877920-65877942 CAGGGGGACTGTAGGCCCCCAGG + Intergenic
1042484865 8:69338017-69338039 CGGAGGGGCTGCAGACGCCCAGG + Intergenic
1047306631 8:123658015-123658037 CAGAGAGACCGCAGCACCACAGG - Intergenic
1048303292 8:133266808-133266830 CAGAGGAACTGCAGCCCCCCGGG - Intronic
1049243617 8:141550687-141550709 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243645 8:141550769-141550791 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243661 8:141550810-141550832 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243677 8:141550851-141550873 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243692 8:141550892-141550914 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243706 8:141550933-141550955 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243738 8:141551015-141551037 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243767 8:141551097-141551119 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243782 8:141551138-141551160 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243825 8:141551261-141551283 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049243898 8:141551466-141551488 CAGAGAGACCCCAGCCCACCAGG - Intergenic
1049382783 8:142325687-142325709 CAGTGGGGCCCCAGAACCCCAGG - Intronic
1049521632 8:143094429-143094451 GATAGGGACAGCAGATCCCCAGG + Intergenic
1049572569 8:143376134-143376156 CAAAGGGACCGGAGGTCCCCAGG - Intronic
1049596904 8:143489029-143489051 CAGTGGCAGCGCTGACCCCCAGG + Intronic
1049683026 8:143928105-143928127 CACAGGGTCAGCTGACCCCCAGG - Intronic
1049770697 8:144379640-144379662 CACTGGGACCAAAGACCCCCAGG + Intronic
1051356526 9:16244129-16244151 CAGAGGTAGCACAGAGCCCCAGG - Intronic
1053450923 9:38193281-38193303 CAGAGGGGCTGCGGACCCACAGG + Intergenic
1060553016 9:124494650-124494672 CAGAGGGACCACTGCCCACCTGG + Intronic
1060915976 9:127390906-127390928 CTGAGGGTCCCCAGACCCTCAGG + Intronic
1061882805 9:133576483-133576505 CAGAGAGGCCTCAGACCCCGGGG - Intergenic
1185573429 X:1152203-1152225 CAGGGCCTCCGCAGACCCCCAGG + Intergenic
1186495136 X:10007042-10007064 CAGAAGGAACGCAGACACCAGGG - Intergenic
1189345475 X:40237913-40237935 CAGCGGGAACGCCGACCTCCCGG + Intergenic
1190333379 X:49248983-49249005 CACAGGGACCTCACACCCTCAGG + Intronic
1190654522 X:52599200-52599222 CAAAGGGGCCGCAGACTGCCAGG + Intergenic
1192356398 X:70408114-70408136 CAGATGGACCCCCGACCCACAGG + Intronic
1196645697 X:118116157-118116179 CAGCGGGACCCCAGACCGTCAGG + Intronic
1197444566 X:126534886-126534908 CACAGGGACTGCAGAATCCCTGG + Intergenic
1197453037 X:126641747-126641769 CAGAGGCACCGCTCACCTCCCGG - Intergenic
1197600123 X:128518395-128518417 CAGAGGACCAGCAGACCCCTGGG + Intergenic
1200035087 X:153321506-153321528 CAGAGTGACCGCGGGCGCCCTGG - Intergenic
1200101291 X:153690124-153690146 CAGAGGGGCCCTAGGCCCCCAGG - Intronic
1201011003 Y:9548116-9548138 CTGAGGGCCCGCTGACCCACCGG + Intergenic
1201272260 Y:12266470-12266492 CAGAGAGACCACAAACCCACCGG - Intergenic