ID: 1067082794

View in Genome Browser
Species Human (GRCh38)
Location 10:43221121-43221143
Sequence GCAGAGGGACCGCAGACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082794_1067082801 14 Left 1067082794 10:43221121-43221143 CCGGGGGTCTGCGGTCCCTCTGC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1067082801 10:43221158-43221180 GACCCTGGGCAATCAGCAGCTGG No data
1067082794_1067082797 -8 Left 1067082794 10:43221121-43221143 CCGGGGGTCTGCGGTCCCTCTGC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082794_1067082799 -1 Left 1067082794 10:43221121-43221143 CCGGGGGTCTGCGGTCCCTCTGC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1067082799 10:43221143-43221165 CTCTGAAGGAACTTGGACCCTGG No data
1067082794_1067082800 0 Left 1067082794 10:43221121-43221143 CCGGGGGTCTGCGGTCCCTCTGC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1067082800 10:43221144-43221166 TCTGAAGGAACTTGGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082794 Original CRISPR GCAGAGGGACCGCAGACCCC CGG (reversed) Intronic
900099242 1:954085-954107 GCAGAGAGACCACCCACCCCTGG + Intronic
900138809 1:1130457-1130479 GCAGAGTGACAGCAGAGACCAGG - Intergenic
900467828 1:2834338-2834360 GCAGTGGGAACGGAGACTCCTGG - Intergenic
900495987 1:2976438-2976460 CCAGGTGGACAGCAGACCCCAGG - Intergenic
900829766 1:4957642-4957664 GAAGAAGGACCTCAGATCCCTGG - Intergenic
904036830 1:27563568-27563590 GCAGAGGGACGGCACCACCCAGG - Intronic
905210269 1:36369360-36369382 GCAGAGAGACGGCAGCCTCCTGG - Intronic
906147674 1:43569586-43569608 GCAGAGGAACAGCTGCCCCCTGG + Exonic
907221728 1:52911873-52911895 GCAGAGGCTCCCCAGATCCCAGG - Intronic
908605308 1:65792249-65792271 GCGCAGGGGACGCAGACCCCCGG - Intergenic
911580700 1:99630262-99630284 GCAGAGGCAGTACAGACCCCTGG + Intergenic
912668521 1:111604818-111604840 TCAGAGAGTCAGCAGACCCCAGG - Intronic
913598830 1:120404052-120404074 GCAGGGGGACCCAAGCCCCCGGG + Intergenic
915574495 1:156766838-156766860 GCAGAGGGAGGCCAGGCCCCAGG + Intronic
915938208 1:160101159-160101181 GCAGAGGGAGCCCACAGCCCAGG + Intergenic
920397801 1:205659502-205659524 GCAGAGGCCCCGCAGAGCGCGGG + Exonic
922161659 1:223082665-223082687 GCAGAGGGACACCAGGCCACAGG + Intergenic
922563041 1:226582790-226582812 GCTGAGGGGCCACAGACCTCAGG + Intronic
922674940 1:227544175-227544197 GCACAGGGACCCCAGACTTCAGG - Intergenic
922731125 1:227949201-227949223 GCACAGTGACCGCAGAACCTGGG + Intergenic
922784336 1:228275674-228275696 ACAGAGGGCCCGCACAGCCCCGG - Intronic
923661113 1:235958180-235958202 GGAGAAGGACCGCAAGCCCCTGG - Intergenic
1062791793 10:311410-311432 TCACAGGGCCTGCAGACCCCCGG + Intronic
1062937537 10:1399530-1399552 GCAGAGGGACCCCAGGCACCAGG - Intronic
1063458881 10:6203183-6203205 GGAGAGCGGCCGCCGACCCCCGG - Intronic
1064119351 10:12605681-12605703 CCAGTGGCACCGCAGCCCCCAGG - Intronic
1066579385 10:36863223-36863245 GCAAAGAGACCACAGACCACAGG + Intergenic
1066755748 10:38711455-38711477 GCAGAGGGTCCCTAGAACCCAGG - Intergenic
1067082794 10:43221121-43221143 GCAGAGGGACCGCAGACCCCCGG - Intronic
1069572992 10:69505860-69505882 GCTGAGGGACTGCAGAGCTCAGG - Intronic
1070321637 10:75358965-75358987 GCAGAAGGACCGCTGCACCCAGG - Intergenic
1070517559 10:77222494-77222516 GCAGAAGGACTGCAGACATCTGG - Intronic
1070527054 10:77304394-77304416 GCAGAGGGGCCCCTAACCCCAGG + Intronic
1070808070 10:79282470-79282492 CCCGAGGGACGGCAGACGCCTGG + Intronic
1071634098 10:87235780-87235802 GCAGAAGGGCGGCAGACCCTCGG - Intronic
1075091304 10:119445496-119445518 GCAGAGGGACAGCAGCACCCTGG - Intronic
1075252060 10:120888383-120888405 GCAGTGTGACTGCAGAGCCCAGG + Intronic
1076340995 10:129744712-129744734 CCACAGGGACCACAGACCACAGG + Intronic
1076666615 10:132096793-132096815 GGCCAGGGACCTCAGACCCCAGG + Intergenic
1076948199 10:133665660-133665682 GGAGGCGGAACGCAGACCCCAGG + Intergenic
1076951157 10:133675568-133675590 GGAGGCGGAACGCAGACCCCAGG + Intergenic
1076952147 10:133678878-133678900 GGAGGCGGAACGCAGACCCCAGG + Intergenic
1076956093 10:133745149-133745171 GGAGGCGGAACGCAGACCCCAGG + Intergenic
1076958070 10:133751768-133751790 GGAGGCGGAACGCAGACCCCAGG + Intergenic
1077613872 11:3661300-3661322 GGAAAGGGACCTCAGAGCCCTGG - Intronic
1083721774 11:64607099-64607121 GGAGAGGGTCCCCAGGCCCCTGG + Exonic
1084429471 11:69103147-69103169 GCAGAAGGGCCTGAGACCCCAGG + Intergenic
1084968644 11:72757518-72757540 GCATGGGGACGGCAGAGCCCAGG + Intronic
1087348294 11:96999279-96999301 GCAGAGGCACCACATGCCCCTGG + Intergenic
1088928643 11:114327194-114327216 GCAGAGGCACTGCAGAGCCTTGG + Intergenic
1090396948 11:126425227-126425249 GAAGGGGGACTGCGGACCCCAGG + Intronic
1091773893 12:3171886-3171908 CCAGAGTGGCCGCAGTCCCCAGG + Intronic
1091836165 12:3587736-3587758 GCAGAGGGACCACACACAGCAGG - Intronic
1092757210 12:11774889-11774911 GCAGAGGGACCGTAGCCCCGGGG + Intronic
1094219151 12:27974720-27974742 GCAGTGGGAGCGCAAACACCAGG - Intergenic
1094499271 12:31008006-31008028 GCAGAAGGGCCGCAGCTCCCTGG + Intergenic
1096741272 12:53695727-53695749 GAAGAGGAACCGCAGATGCCGGG + Intergenic
1096848011 12:54418591-54418613 GCAGAGGGGGCGCAGAGGCCGGG - Intronic
1098481383 12:70965306-70965328 GCAGAGCCACCGCAGACCCAAGG - Intergenic
1102014049 12:109636288-109636310 GCAGAGAGAAGGCAGAGCCCTGG + Intergenic
1102482958 12:113236491-113236513 GGAGAGGGACCGAACATCCCAGG + Intronic
1102503991 12:113372458-113372480 GGATAGGGACCCCAGGCCCCTGG - Intronic
1104078040 12:125407709-125407731 CCAAAGGGACCGCGGACACCTGG + Intronic
1104638456 12:130452179-130452201 ACAGAGGGACCGAGGACCCCAGG - Intronic
1104858393 12:131912543-131912565 TCAGAGGAGCCACAGACCCCAGG - Intronic
1104981701 12:132575889-132575911 GCAGAGGCAGCGCAGTCACCAGG + Intronic
1105669851 13:22600865-22600887 TCAGGGGGTCCTCAGACCCCAGG - Intergenic
1105704922 13:22962713-22962735 TGAGAGTCACCGCAGACCCCAGG - Intergenic
1113415768 13:110127294-110127316 GCAGAAGATCCACAGACCCCTGG + Intergenic
1113416266 13:110131070-110131092 GCAGAAGATCCGCAGACCCCTGG + Intergenic
1116082361 14:40190866-40190888 GCAGAGTGGCCACAGAGCCCAGG - Intergenic
1121433800 14:93905764-93905786 GCAGATGGCCCACAGACACCAGG + Intergenic
1121565558 14:94906895-94906917 GCAGTGGGAGGGCAAACCCCAGG + Intergenic
1122300688 14:100729368-100729390 CCGGTGGGACCACAGACCCCAGG + Intronic
1128085964 15:64886948-64886970 GCAGGGGGACCCAAGGCCCCGGG - Intronic
1128431002 15:67593382-67593404 GCAGAGTGACAGCAGACCTTTGG + Intronic
1132627894 16:900920-900942 GCAGAGGCATCGCAGGCCCACGG - Intronic
1133112136 16:3554374-3554396 GCAGAGAGAGTTCAGACCCCTGG - Intronic
1133367862 16:5225324-5225346 GCAGAGGCACCACAGGCCTCTGG + Intergenic
1135023761 16:18983876-18983898 GCAGAGGGGCTGCAGAGCCCGGG - Intergenic
1136355747 16:29744213-29744235 TCAGTGGGACCGGGGACCCCAGG - Exonic
1136448607 16:30339362-30339384 GCAGGAGGATCGCTGACCCCAGG + Intergenic
1137928918 16:52567947-52567969 GCAGAGGAGCCGAAGTCCCCTGG - Intergenic
1139749880 16:69103313-69103335 CCAGAGGCATCACAGACCCCTGG - Intergenic
1140128550 16:72137673-72137695 GCAGAAGGACCCCAAGCCCCAGG - Intronic
1140259043 16:73361398-73361420 GGAGAGGGACCACAGAGCTCTGG + Intergenic
1141992794 16:87620139-87620161 CCTGAGGGACCCCAGAGCCCAGG - Intronic
1142243193 16:88956386-88956408 GCAGAGAGCCCTGAGACCCCTGG - Intronic
1142923812 17:3215023-3215045 TCAGAGGGATCCCAGAGCCCAGG - Intergenic
1144892390 17:18501389-18501411 CCTGTGGGACCGCCGACCCCTGG - Intergenic
1145139824 17:20442899-20442921 CCTGTGGGACCGCCGACCCCTGG + Intergenic
1145236300 17:21210582-21210604 GCAGATGGAGCACAGGCCCCGGG - Intronic
1145796039 17:27655780-27655802 CCTGTGGGACCGCCGACCCCTGG - Intergenic
1146446133 17:32934287-32934309 GCAGTGGGACATGAGACCCCTGG - Exonic
1148388709 17:47254563-47254585 GCAGAGGCACCGCTGCCACCTGG - Intronic
1149430344 17:56592659-56592681 GCAGAGGGCGCGCCGCCCCCAGG + Intergenic
1150136957 17:62701395-62701417 GCAGTGGGACCCCAGGCCACTGG + Exonic
1151562495 17:74878160-74878182 GCAGGTGGCCCCCAGACCCCAGG + Exonic
1151943419 17:77306512-77306534 GCAGAGGGAGCGCATGCCGCGGG + Intronic
1152702912 17:81828330-81828352 CCAGGGGGACAGCAGGCCCCTGG - Intronic
1152735721 17:81995936-81995958 GCACCGGGACCCCAGAGCCCAGG - Intronic
1157478904 18:48040305-48040327 GCAAAGGCACCGAAGTCCCCTGG + Exonic
1158643184 18:59220322-59220344 GCAGCGGGACCGCTCGCCCCCGG - Exonic
1159602985 18:70446274-70446296 GCTGAGGGACAGCTGACACCTGG - Intergenic
1160538240 18:79606796-79606818 GCAGGGAGACCCCAGATCCCAGG + Intergenic
1160659260 19:290860-290882 GCAGCGGGAGCGCCCACCCCAGG + Intronic
1160930914 19:1568960-1568982 GGAGAGGGACCTCAGGCCCTGGG - Intergenic
1161473532 19:4472813-4472835 GCCGAGGACCCCCAGACCCCGGG - Intronic
1161473561 19:4472892-4472914 GCCCAGGGCCCCCAGACCCCGGG - Intronic
1161951679 19:7471140-7471162 GCACAGGGTCCTCAGCCCCCGGG + Exonic
1162087231 19:8256162-8256184 CCAAAGAGACCGCAGACCCAGGG + Intronic
1163374284 19:16920983-16921005 GCAGAGGCCCCGCCCACCCCAGG - Intronic
1163669210 19:18617697-18617719 GGAGATGGACTGCAGAACCCTGG - Intronic
1164677691 19:30112667-30112689 GCAGAGGGAAGGGAGAGCCCTGG + Intergenic
1164729711 19:30494228-30494250 GTAGGGGGACCGTAGGCCCCTGG + Intronic
1166092477 19:40519327-40519349 GCGGAGGGCCCGCCGACCCAGGG - Intronic
1167710556 19:51108015-51108037 GAAGAGAGGCCGCGGACCCCAGG + Intronic
1168156202 19:54474115-54474137 GCAGAGGGTTCTCAGACACCAGG + Intergenic
1168599885 19:57709024-57709046 GGATAGGGACCGCTGTCCCCGGG - Exonic
926052076 2:9751769-9751791 CCAGAGGGACCGTGGCCCCCAGG + Intergenic
927772858 2:25878586-25878608 GGCGAGGTACCGCAGACCGCCGG - Intergenic
928174330 2:29023732-29023754 GCAGAGGAAACAGAGACCCCAGG - Intronic
931263909 2:60643528-60643550 GCAGAGTGACAGCCAACCCCAGG + Intergenic
931311702 2:61087496-61087518 GCAGTGGCACCTCAGACTCCTGG - Intronic
933708157 2:85306577-85306599 GCAGAGGACGCTCAGACCCCAGG + Intronic
934319049 2:91955687-91955709 GCAGAGGGTCCCTAGAACCCAGG - Intergenic
934902021 2:98167097-98167119 GCTCAGGGCCTGCAGACCCCAGG + Intronic
935292057 2:101619343-101619365 GGAGAAGGAACGCAGGCCCCTGG - Intergenic
937914979 2:127094536-127094558 ACAGAGGGACCGGAGCTCCCAGG - Intronic
938068549 2:128294564-128294586 TCAGAGGGGCCGCAGCTCCCAGG - Intronic
945589302 2:211709896-211709918 GCAGAGGAACAGCTGACCACTGG - Intronic
946249039 2:218402005-218402027 CCAGAGGAACCCCAGGCCCCAGG - Intronic
946307867 2:218866177-218866199 GCAGAGGGAGCCCTGAGCCCTGG - Intronic
946334898 2:219029969-219029991 GTAGAGGTACCGGTGACCCCAGG - Exonic
946391460 2:219419097-219419119 ACAGCGGGACCCCAGACCCCAGG - Intronic
947501674 2:230675493-230675515 GCAGAGGGACAGCTGGGCCCAGG - Intergenic
948088011 2:235266890-235266912 GCAGAGGGGGTGCAAACCCCAGG - Intergenic
948736860 2:240014503-240014525 ACAGTGGGACCGCAGAGCACTGG + Intronic
949049951 2:241892323-241892345 GGAGAGGGACGCCAGCCCCCAGG - Intergenic
949073368 2:242040052-242040074 ACAGAGGGGCCCCAGACACCTGG + Intergenic
1169171329 20:3468204-3468226 GCAGGGGGATCACAGAGCCCAGG - Intergenic
1169344754 20:4821445-4821467 GAAAAGGGACCTCAGATCCCTGG + Intronic
1172096342 20:32462348-32462370 GCAGAGCGATCCCAGCCCCCGGG - Intronic
1172444579 20:34986304-34986326 GAAGAGAGGCCACAGACCCCAGG - Intronic
1173247104 20:41344544-41344566 GCAGAGGGGCAGCAGGCCACTGG + Intronic
1175028995 20:55933570-55933592 CCAGAGGGCTTGCAGACCCCAGG - Intergenic
1175162866 20:57021827-57021849 GCAGAGGGACTGGAGAGCTCAGG - Intergenic
1175260253 20:57669776-57669798 GAGGAGGGACCACAGACACCAGG + Intronic
1175900028 20:62356333-62356355 CCGGAGCGAGCGCAGACCCCTGG + Intronic
1175919888 20:62445892-62445914 GCAGTGTGAACACAGACCCCCGG - Intergenic
1175920562 20:62448779-62448801 GCAGTGTGAACACAGACCCCTGG - Intergenic
1176371806 21:6066861-6066883 TCACAGGTGCCGCAGACCCCTGG + Intergenic
1179026843 21:37686048-37686070 GCAGAGGGACTGCAGAACAGAGG + Intronic
1179112934 21:38463000-38463022 GCTGAGGGACTGCAGAGCCCGGG + Intronic
1179751713 21:43471678-43471700 TCACAGGTGCCGCAGACCCCTGG - Intergenic
1180307228 22:11139352-11139374 GCAGAGGGTCCCTAGAACCCAGG - Intergenic
1180545748 22:16501536-16501558 GCAGAGGGTCCCTAGAACCCAGG - Intergenic
1180869627 22:19138819-19138841 GCAGAGGGAGCCCAGCCCCAGGG - Intronic
1180961201 22:19763159-19763181 GCAGAGGGGCCGCCAGCCCCAGG + Intronic
1181022123 22:20109059-20109081 GTGGAGGGACAGCAGACCCCAGG + Intronic
1181539883 22:23567395-23567417 GCAAAGGCAACGCAGCCCCCAGG + Intergenic
1182765023 22:32752594-32752616 GGACAGGGACAGCAGAGCCCCGG - Intronic
1183177219 22:36232974-36232996 GCAGATGACCCCCAGACCCCTGG + Intronic
1183180610 22:36257563-36257585 GCAGATGACCCCCAGACCCCTGG - Intronic
1184033091 22:41906175-41906197 GGGGAGGGAACGCAGACCCAGGG - Exonic
1184644658 22:45889431-45889453 TCGGATGGACCTCAGACCCCTGG - Intergenic
1184662877 22:45973495-45973517 GCAGAGGGGCCCGAGAGCCCTGG - Intronic
1185271960 22:49933946-49933968 GCCGGGGCACAGCAGACCCCCGG + Intergenic
950538338 3:13594760-13594782 ACAGAGGGACCCCAGAGCCCGGG + Intronic
950795868 3:15510478-15510500 GCAGGTGGATCGCTGACCCCAGG + Intronic
952968125 3:38633464-38633486 GCAGAGAGGCTCCAGACCCCAGG + Intronic
953875941 3:46666985-46667007 CCAGAGGGACGGCTGACCACTGG - Intergenic
955456745 3:59129931-59129953 GCCTAGGGACCAGAGACCCCTGG - Intergenic
960619292 3:119623471-119623493 CCAGAGGGACAGCAGGTCCCAGG + Intronic
962283868 3:134070973-134070995 GCAGTGGGACAGCTGACCACAGG - Intronic
963074663 3:141334662-141334684 GGAGAGGCACTGCAGACCACAGG - Intronic
966684522 3:182679418-182679440 GGAGAGAGACTGCAGTCCCCAGG - Intergenic
967666933 3:192183845-192183867 GCAAAGAGAGGGCAGACCCCTGG - Intronic
968548787 4:1212185-1212207 GCAGAGGGCCCGGAAACCCTCGG - Exonic
978654843 4:111052637-111052659 GCAAAGGGGCTACAGACCCCAGG - Intergenic
985129688 4:186726851-186726873 CCAGAGAGACCGCAGAGGCCGGG - Intergenic
985530484 5:431112-431134 GCAGAGGGGACGCAGCCCCCTGG + Intronic
985748221 5:1659832-1659854 GCACCCGGACCTCAGACCCCCGG - Intergenic
986829829 5:11563928-11563950 GCAGAGTGGCTGCTGACCCCAGG + Intronic
987372207 5:17203562-17203584 GCAAAGGCACTGCAGAGCCCTGG - Intronic
987444480 5:18000924-18000946 GCAGACAAACCGCAGCCCCCTGG - Intergenic
988841480 5:35087786-35087808 AAAGAGGGACAGCAGAGCCCTGG + Intronic
989436414 5:41418365-41418387 GCATATGGAGAGCAGACCCCAGG - Intronic
991676598 5:69094433-69094455 GGAGAGGGCGCGCCGACCCCGGG - Intronic
992260643 5:74966785-74966807 GCAGACTGACCACAGTCCCCTGG - Intergenic
992570044 5:78046139-78046161 GCAGAGGGTCCCCAGTCCCTGGG + Intronic
998327049 5:141290067-141290089 TCAGAGGGTCCCAAGACCCCAGG - Intergenic
1001415612 5:171543074-171543096 GAAGAGGGGCCGGACACCCCTGG + Intergenic
1002582321 5:180216242-180216264 CCAGAGGGCCCGCAGACAACCGG + Intergenic
1002641380 5:180632198-180632220 CCAGAGGGTCCGCACATCCCAGG + Intronic
1003778764 6:9398981-9399003 GCAGAGGAACCGCAAGGCCCGGG - Intergenic
1006383769 6:33717291-33717313 GCAGAGAGGCAGCAGATCCCTGG - Intergenic
1014284211 6:119478322-119478344 GAAGAGGGAAAGCAGACACCTGG - Intergenic
1014754661 6:125289640-125289662 GCATAAGGACCCCAGAACCCTGG - Intronic
1015577613 6:134689859-134689881 GCAGAGGTACCTCCGGCCCCAGG - Intergenic
1018690711 6:166342305-166342327 GCAGAGGAGTCCCAGACCCCCGG + Intronic
1019254635 7:41385-41407 ACAGGGAGACTGCAGACCCCAGG + Intergenic
1020120240 7:5499143-5499165 GGAGGGGGACCACAGACTCCTGG - Intronic
1022409851 7:30131061-30131083 CAAGAGGGACTGTAGACCCCAGG - Intergenic
1024307095 7:47938182-47938204 GCACAGGGAGCGCACATCCCAGG - Intronic
1025205820 7:56992901-56992923 GCGGAGCGGCCGCTGACCCCGGG + Intergenic
1025666120 7:63584037-63584059 GCGGAGCGGCCGCTGACCCCGGG - Intergenic
1027159153 7:75789790-75789812 CCAGGGGTACCGCAGATCCCAGG - Exonic
1029573377 7:101386533-101386555 GCAGCTGAACCGCAGGCCCCTGG + Intronic
1029647195 7:101865133-101865155 GCAGGGGGAACCCAGGCCCCAGG - Intronic
1029654189 7:101913543-101913565 GGAGGGGGCCCACAGACCCCCGG + Intronic
1032112611 7:129089475-129089497 GCAGACTGACCTCAGAGCCCTGG - Intergenic
1032934960 7:136718300-136718322 ACCGAGGGACTGCAGACTCCTGG - Intergenic
1034294423 7:149959281-149959303 TCAGAGGCACCACAGACCCTTGG + Intergenic
1034480702 7:151318314-151318336 CCAGAGGGACTGCACACCTCTGG + Intergenic
1034811632 7:154137573-154137595 TCAGAGGCACCACAGACCCTTGG - Intronic
1035062468 7:156079700-156079722 GCAGGGAGAGCACAGACCCCAGG - Intergenic
1036787598 8:11698164-11698186 GGAGAGAGACCACAGACCCTGGG - Intronic
1040549964 8:48430148-48430170 GCAGAGGGACAGCAGATTACTGG - Intergenic
1048259902 8:132936693-132936715 GAAGAGCGAGCGCAGACCTCAGG - Intronic
1048303293 8:133266809-133266831 CCAGAGGAACTGCAGCCCCCCGG - Intronic
1048336556 8:133506994-133507016 GCAGAGGGACCTCAAAACCCAGG + Intronic
1048979504 8:139695602-139695624 GGAAAGGGACCTCAGACTCCAGG + Intronic
1049171481 8:141164136-141164158 GCAGACAGAGCGCAGACCGCAGG - Intronic
1055036364 9:71822582-71822604 TCAGAGGGGCTGCAGACCACAGG + Intergenic
1056963553 9:91147340-91147362 ACAGAGGGACCACCCACCCCAGG - Intergenic
1058702885 9:107615186-107615208 GCAGAGGGAACGAAGGCCCATGG + Intergenic
1059434155 9:114266399-114266421 GAAGAGGGGCTGCAGACACCAGG + Intronic
1061882806 9:133576484-133576506 GCAGAGAGGCCTCAGACCCCGGG - Intergenic
1061989990 9:134153628-134153650 GCTGAGGGAGCGGAGACGCCAGG + Intronic
1062030228 9:134358859-134358881 GCAGAGGGCCAGGAGTCCCCGGG + Intronic
1062274971 9:135726257-135726279 GCACAGGGCCAGCAGCCCCCGGG + Intronic
1062666086 9:137673273-137673295 GGTGAGGGACCACAAACCCCTGG - Intronic
1203786771 EBV:132581-132603 GGAGAGGGCACACAGACCCCGGG - Intergenic
1186495137 X:10007043-10007065 GCAGAAGGAACGCAGACACCAGG - Intergenic
1191731704 X:64343270-64343292 TCAGGGGGTCCACAGACCCCTGG - Intronic
1197600122 X:128518394-128518416 TCAGAGGACCAGCAGACCCCTGG + Intergenic