ID: 1067082797

View in Genome Browser
Species Human (GRCh38)
Location 10:43221136-43221158
Sequence CCCTCTGCTCTGAAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082788_1067082797 4 Left 1067082788 10:43221109-43221131 CCATCCCTCCACCCGGGGGTCTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082792_1067082797 -4 Left 1067082792 10:43221117-43221139 CCACCCGGGGGTCTGCGGTCCCT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082791_1067082797 -1 Left 1067082791 10:43221114-43221136 CCTCCACCCGGGGGTCTGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082794_1067082797 -8 Left 1067082794 10:43221121-43221143 CCGGGGGTCTGCGGTCCCTCTGC 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082790_1067082797 0 Left 1067082790 10:43221113-43221135 CCCTCCACCCGGGGGTCTGCGGT 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082781_1067082797 29 Left 1067082781 10:43221084-43221106 CCCTGCTGGGAGAAGAGGAGTGA 0: 1
1: 0
2: 2
3: 49
4: 405
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082787_1067082797 5 Left 1067082787 10:43221108-43221130 CCCATCCCTCCACCCGGGGGTCT 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082782_1067082797 28 Left 1067082782 10:43221085-43221107 CCTGCTGGGAGAAGAGGAGTGAT 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data
1067082793_1067082797 -7 Left 1067082793 10:43221120-43221142 CCCGGGGGTCTGCGGTCCCTCTG 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082797 Original CRISPR CCCTCTGCTCTGAAGGAACT TGG Intronic
No off target data available for this crispr