ID: 1067082904

View in Genome Browser
Species Human (GRCh38)
Location 10:43221637-43221659
Sequence CCTAACCTGCAAATGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 142}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067082904_1067082907 -10 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082907 10:43221650-43221672 GCAGGTTAGGCTGCAAGCGCAGG No data
1067082904_1067082915 9 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082915 10:43221669-43221691 CAGGGCAGCGAGGTGGGGTGGGG No data
1067082904_1067082916 10 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082916 10:43221670-43221692 AGGGCAGCGAGGTGGGGTGGGGG No data
1067082904_1067082914 8 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082914 10:43221668-43221690 GCAGGGCAGCGAGGTGGGGTGGG No data
1067082904_1067082909 -1 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082909 10:43221659-43221681 GCTGCAAGCGCAGGGCAGCGAGG No data
1067082904_1067082912 4 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082912 10:43221664-43221686 AAGCGCAGGGCAGCGAGGTGGGG No data
1067082904_1067082918 23 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082918 10:43221683-43221705 GGGGTGGGGGAAATCAGGCCAGG No data
1067082904_1067082910 2 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082910 10:43221662-43221684 GCAAGCGCAGGGCAGCGAGGTGG No data
1067082904_1067082917 18 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082917 10:43221678-43221700 GAGGTGGGGTGGGGGAAATCAGG No data
1067082904_1067082919 24 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082919 10:43221684-43221706 GGGTGGGGGAAATCAGGCCAGGG No data
1067082904_1067082913 7 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082913 10:43221667-43221689 CGCAGGGCAGCGAGGTGGGGTGG No data
1067082904_1067082911 3 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082911 10:43221663-43221685 CAAGCGCAGGGCAGCGAGGTGGG No data
1067082904_1067082908 -9 Left 1067082904 10:43221637-43221659 CCCTGCTGCATTTGCAGGTTAGG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1067082908 10:43221651-43221673 CAGGTTAGGCTGCAAGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067082904 Original CRISPR CCTAACCTGCAAATGCAGCA GGG (reversed) Intronic
902680348 1:18039626-18039648 CCAAACCTCCCAAGGCAGCAGGG - Intergenic
902680532 1:18041039-18041061 TCAAACCTCCAAAGGCAGCAGGG - Intergenic
906955428 1:50370074-50370096 CCTGACCTCCAATTGCAGCTGGG + Intergenic
907298139 1:53468693-53468715 CCTGACCTGCCAGTACAGCAGGG + Intergenic
907416933 1:54320995-54321017 CCTAGCAAGCAAAAGCAGCAAGG + Intronic
910401550 1:86842691-86842713 ACTAACCTGTAAGTGCTGCAGGG - Intergenic
911679688 1:100700799-100700821 ACTAATCTGCAAATGAGGCAGGG - Intergenic
923090806 1:230739739-230739761 CCAAACCTGCCACTGGAGCAGGG - Intergenic
923286730 1:232503198-232503220 CCTATCATGCAAATACAACAGGG + Intronic
1066332041 10:34434220-34434242 CCTAACCTGGGAATGCACCCTGG + Intronic
1067082904 10:43221637-43221659 CCTAACCTGCAAATGCAGCAGGG - Intronic
1069634794 10:69918545-69918567 ACTAGCCTGCCAATGCACCAAGG + Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070698811 10:78583924-78583946 CCAACCCTGCATTTGCAGCAGGG + Intergenic
1070835762 10:79445892-79445914 GCTCATCTGCATATGCAGCACGG + Intergenic
1071697134 10:87888164-87888186 CCTAACCTGTGAAAGCTGCATGG + Intronic
1071773670 10:88759880-88759902 CCCAACCTGCAAGTGCATCATGG + Intergenic
1072675756 10:97464897-97464919 CCTAACCAGCCGATGCAACATGG - Intronic
1077136638 11:1002850-1002872 CCTAAGAAGCAAATGCTGCACGG - Intronic
1077403030 11:2368373-2368395 CCCAACCTGCAAATGCAGACAGG + Intergenic
1077506631 11:2932578-2932600 CCCAAGCTGCAGATGCAGAAAGG + Intergenic
1078095752 11:8295862-8295884 CCCAACATGCAAGTGCTGCAAGG + Intergenic
1080934292 11:36845819-36845841 CCCAACCTGCAAATGAAGCTGGG - Intergenic
1089384631 11:118059717-118059739 CCTTACCTGGAAAAGCAGCCTGG + Intergenic
1090514153 11:127407119-127407141 ACTAACATGCAAGTGCAGCAAGG - Intergenic
1090723984 11:129505287-129505309 CTGAAGCTGCAAATGCAGAAAGG + Intergenic
1091420310 12:333494-333516 CCCAACGTGCTAATGGAGCATGG - Exonic
1093027834 12:14260724-14260746 CCGCACCCGCAAATGCAGCCAGG + Intergenic
1097055135 12:56244595-56244617 CCCATCCTGCAAATGCCCCAGGG + Intronic
1097572991 12:61356463-61356485 CCAAACCTGCAGGGGCAGCAGGG + Intergenic
1100448045 12:94679082-94679104 CATAACCTGCAAAAGCACAAAGG - Intergenic
1102499475 12:113341598-113341620 CCTTACCTTCAGGTGCAGCAGGG - Intronic
1104078241 12:125409321-125409343 TCCAAATTGCAAATGCAGCAAGG + Intronic
1105209615 13:18250120-18250142 GCTGTCCTGGAAATGCAGCATGG + Intergenic
1105937288 13:25114457-25114479 CCACACCCGCAAATGCAGCAGGG - Intergenic
1106285145 13:28312222-28312244 CCAAACCTAAAAATGAAGCAGGG - Intronic
1106842602 13:33700462-33700484 CCTATCTTGCAAATGCACAAAGG - Intergenic
1107087536 13:36442179-36442201 AATACCCTGTAAATGCAGCAAGG - Exonic
1111929224 13:94496726-94496748 CCTAACCTGCATGTTCACCATGG + Intergenic
1116065277 14:39974097-39974119 CCTAGCCTGATGATGCAGCATGG + Intergenic
1119627870 14:76197398-76197420 CCCAACCTGAAAATGGAACAAGG - Intronic
1124167797 15:27343489-27343511 CCTAACCTCCAAAATCAACAAGG - Intronic
1126245953 15:46505902-46505924 CCCAAACTGGAAATGCAACAAGG - Intergenic
1126400351 15:48262385-48262407 CATTTCCTGCAACTGCAGCATGG + Intronic
1128470382 15:67946608-67946630 CCTGACAAGCAAATGCACCAGGG + Intergenic
1128715430 15:69904427-69904449 CCTAACCTCCGAAAGCAGAAGGG - Intergenic
1131021667 15:89104355-89104377 CCTCCCCTGCCAATTCAGCAGGG - Intronic
1131147313 15:90022414-90022436 TCAAACATGCAAAGGCAGCAAGG + Intronic
1131980153 15:97987003-97987025 CCTAGGCTGCAAATGCTGCAGGG - Intergenic
1132721415 16:1318104-1318126 CCCAGCCAGCAAATGCGGCAGGG + Intronic
1132968597 16:2673574-2673596 CCCAACCCGGAAATGCAGCTGGG - Intergenic
1134667134 16:16026963-16026985 CCTGCCCTGCAAATGCAACAAGG - Intronic
1139596703 16:67962319-67962341 CCTGACCTGGGAAAGCAGCAAGG - Intronic
1140044582 16:71432104-71432126 CCTCACCTGCAAGTCCAGCTGGG + Intergenic
1140236496 16:73164044-73164066 CCGATCCTGCAACTGCCGCAAGG + Intergenic
1142322766 16:89394984-89395006 CCAAACCAGCAAATACATCACGG + Intronic
1144966632 17:19080585-19080607 GCTAACCTGCAGATGCATCAGGG + Intergenic
1144981286 17:19171472-19171494 GCTAACCTGCAGATGCATCAGGG - Intergenic
1144986938 17:19206767-19206789 GCTAACCTGCAGATGCATCAGGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1149830507 17:59867702-59867724 CTTATCCTCCAAAAGCAGCATGG - Intronic
1150349512 17:64431956-64431978 CCTAACCTGGGAATGCAGTCCGG + Intergenic
1150520840 17:65865718-65865740 CCTCACCTGCCACTGCTGCAGGG + Intronic
1151700291 17:75739367-75739389 CCTAACCTGCAAGAGGGGCATGG + Intronic
1152348720 17:79771023-79771045 CCTTTCCTGCTGATGCAGCAGGG + Intergenic
1153580597 18:6569835-6569857 CCTAATCTGCAGTTGCAGGAAGG + Intronic
1153716737 18:7857610-7857632 CCCTTCCTGCAAATGGAGCATGG + Intronic
1155624910 18:27823387-27823409 GCTAACGTGCAAATGCAACGGGG + Intergenic
1155766143 18:29635423-29635445 GCTAAACTGCAAAAGGAGCAGGG - Intergenic
1157385478 18:47256502-47256524 CCAAACCTGTAAACACAGCAAGG + Intergenic
1159116827 18:64123970-64123992 CCTCACCTCCAAAAGCAGAAGGG - Intergenic
1159257901 18:65972643-65972665 TCTAACCTTGAAATTCAGCAAGG - Intergenic
1160593911 18:79961512-79961534 CCTGACCTGAAAAAGCAGCCAGG + Intergenic
1161070313 19:2256528-2256550 CCTTCCCTGCCATTGCAGCAGGG + Intronic
1163410313 19:17149871-17149893 CCAGACCTGCAGATGCAGCACGG + Intronic
1163773433 19:19204357-19204379 CCTAACCACTAAATGCAGCCTGG + Intergenic
1164857773 19:31538422-31538444 CCTCACCTGTAAATCCAGCCTGG + Intergenic
1168272350 19:55257243-55257265 CGTGCGCTGCAAATGCAGCAAGG - Intronic
925272158 2:2619281-2619303 CCTAACCTTAAAAATCAGCAGGG + Intergenic
927055663 2:19363546-19363568 CCGAGCTTGCAAATGCAGGATGG - Intergenic
929420220 2:41782709-41782731 CCTTACCTGAAAATGCAGGGTGG + Intergenic
933291104 2:80439278-80439300 CCTAACATTAAAATGCAGCAGGG - Intronic
933623228 2:84568691-84568713 CCTATCCTGCACATGCATCCTGG + Intronic
935356778 2:102208673-102208695 CCTGTCCTGCATAGGCAGCAGGG - Intronic
935675730 2:105593799-105593821 CCTTGCCTGAGAATGCAGCATGG + Intergenic
937256759 2:120561189-120561211 CCTCAGCTGCAAAGGCTGCAAGG + Intergenic
938876766 2:135539619-135539641 CCTAACTTTTAAATGCACCAGGG - Intronic
939462074 2:142509957-142509979 CCTAACAAGCAATTGAAGCATGG + Intergenic
946250317 2:218407395-218407417 GCAATTCTGCAAATGCAGCACGG + Intergenic
947371189 2:229447427-229447449 CTTTACCTGCAACTGCAGCCCGG - Exonic
1170364886 20:15587833-15587855 ACTAGCCTGCAAAAGCAGCCAGG - Intronic
1171051416 20:21862669-21862691 CCCAGCCTGCAACTGCAGCCAGG - Intergenic
1171290776 20:23981787-23981809 GCTGTCCTGGAAATGCAGCATGG + Intergenic
1174275732 20:49402658-49402680 CCTAACCAGCTACTGCAGCTAGG + Intronic
1175276156 20:57772340-57772362 GCTAACCTCCAAATGCTGCCTGG - Intergenic
1177868162 21:26537645-26537667 CTTAACCTCCAACTGCAGCAGGG + Intronic
1180766651 22:18349279-18349301 GCTGTCCTGGAAATGCAGCATGG - Intergenic
1180779663 22:18513099-18513121 GCTGTCCTGGAAATGCAGCATGG + Intergenic
1180812378 22:18770420-18770442 GCTGTCCTGGAAATGCAGCATGG + Intergenic
1181198538 22:21204667-21204689 GCTGTCCTGGAAATGCAGCATGG + Intergenic
1181401197 22:22651133-22651155 GCTGTCCTGGAAATGCAGCATGG - Intergenic
1181648331 22:24245756-24245778 GCTGTCCTGGAAATGCAGCATGG + Intergenic
1181969974 22:26682479-26682501 AGTAACCTGCAATTGGAGCATGG - Intergenic
1184889786 22:47372581-47372603 CATAACCTCCAGATGCATCATGG + Intergenic
1203228267 22_KI270731v1_random:90170-90192 GCTGTCCTGGAAATGCAGCATGG - Intergenic
950183299 3:10929833-10929855 CCTAACCTGCAAGCCCAGCAGGG - Intronic
950884055 3:16347424-16347446 CCTAGCCTCCAAAAGGAGCATGG - Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
962485436 3:135838170-135838192 CCTAACATGTAAATGCAGGACGG - Intergenic
966476323 3:180351819-180351841 TCTAACCTGCAAGTTCAGAAGGG - Intergenic
970551973 4:17190752-17190774 CTTCACCTGCAAATGCTGCATGG - Intergenic
973973594 4:56240272-56240294 CCTAACCTCCACATGCTACAGGG - Intronic
976205239 4:82617895-82617917 CCTATCCTAAAAATGCTGCATGG + Intergenic
977487442 4:97666175-97666197 CCAACCCTGCAAATTCAGAAGGG + Intronic
978962047 4:114692085-114692107 CCTGACCTATAAATGGAGCAGGG + Intergenic
980737599 4:136911484-136911506 CCTAACCTCTCAATGCAGGAAGG + Intergenic
980891008 4:138815771-138815793 CGTAACCTGCAAATTCCACAAGG - Intergenic
986511289 5:8508934-8508956 CCAAACCTGCAAAGGCAGAGGGG - Intergenic
986533435 5:8762100-8762122 GCCAGCCTGCAAATGCAGCCTGG + Intergenic
987999357 5:25330137-25330159 CCGGGCTTGCAAATGCAGCATGG + Intergenic
988602604 5:32653836-32653858 GCTCACCTCCAAATGCAGCATGG - Intergenic
988614692 5:32764163-32764185 CCTAAACTGCACATGCACGAAGG - Intronic
988649914 5:33137877-33137899 CTTGACCTGCAAGTGCAGAATGG - Intergenic
989239990 5:39193011-39193033 CCTAACCTGCAAATGCCTTGAGG - Intronic
993462843 5:88206163-88206185 CCTAACCTACACATTCAACAGGG + Intronic
993908347 5:93649416-93649438 GCTAGCCTGCACATGCAGGAAGG - Intronic
994073378 5:95625185-95625207 CCTAACCTACAAATGCCTCCAGG - Intergenic
995902259 5:117083569-117083591 CATCACCTGTAAATGCAGCCTGG + Intergenic
995969844 5:117954738-117954760 CCTAAACTACAAATGCAGTTGGG - Intergenic
996752505 5:126903214-126903236 CCTCAACTGTAAATGCAGGAAGG + Intronic
1000245606 5:159446367-159446389 CCTGACCTGGAAATGTAGCGGGG + Intergenic
1000515498 5:162233101-162233123 ACCAACCTGTAAATGCAGCCAGG + Intergenic
1005404146 6:25467522-25467544 CCCAACCTGCAATTACAGGAAGG + Intronic
1006797354 6:36740287-36740309 GCTCTCCTGCAAATGCACCAAGG + Intergenic
1007675649 6:43592376-43592398 ACAAAGCTGCAAATGCAGGAGGG - Intronic
1012628565 6:101434206-101434228 CCTCACCTCCAATTGGAGCATGG - Intronic
1014403301 6:121017282-121017304 CATATTCTGTAAATGCAGCAGGG - Intergenic
1015978825 6:138818671-138818693 GCTCAACTTCAAATGCAGCATGG + Intronic
1016314693 6:142772529-142772551 CCCAAACTGCAGATGCAGGAAGG - Exonic
1017057910 6:150454452-150454474 CCTCACCTGGAAAACCAGCAGGG + Intergenic
1022303333 7:29122253-29122275 GCTCAACTCCAAATGCAGCACGG + Intronic
1023872168 7:44269122-44269144 CTCACCCTGCAGATGCAGCAGGG - Intronic
1027187273 7:75979937-75979959 CATCAACTGCAAATGCAGCCTGG - Intronic
1029899894 7:104028105-104028127 GCTTAACTGCAAATGCAGGATGG + Intergenic
1030558099 7:111051977-111051999 CCTAAACTCCAAAGGGAGCATGG - Intronic
1032059777 7:128714956-128714978 CATAACCTGCAGATCCACCAGGG + Intronic
1033249247 7:139744837-139744859 GCTAACCAGCAACTGCAGAACGG + Intronic
1035859094 8:3008913-3008935 CCTCACATGCAAGTACAGCAAGG + Intronic
1039663017 8:39487699-39487721 CCTTACCTGCATATTAAGCAGGG - Intergenic
1039856026 8:41415053-41415075 CGTAAGCTGAAAATGCAGCAGGG + Intergenic
1039980919 8:42409423-42409445 ACTCATCTGGAAATGCAGCAAGG - Intergenic
1045956268 8:107911329-107911351 CCTAACCTGGAGAAGTAGCAGGG + Intronic
1048907906 8:139105939-139105961 CATAACCTGCCAATGGGGCAAGG + Intergenic
1051493938 9:17697723-17697745 CCTAACCTTGGAATGCACCAAGG + Intronic
1052260661 9:26512840-26512862 CCTAACATGCACAACCAGCATGG + Intergenic
1053206619 9:36191361-36191383 CCTAACCTCCTAATTCAGCAAGG - Intronic
1053537131 9:38937335-38937357 ACTGGGCTGCAAATGCAGCATGG + Intergenic
1057297265 9:93856156-93856178 GCTAAGCTGCAAATGCATTAAGG - Intergenic
1191755813 X:64591224-64591246 GCTCAACTCCAAATGCAGCAGGG + Intergenic
1194891278 X:99383350-99383372 CCTACCCTGCCACAGCAGCAGGG - Intergenic
1197969532 X:132100754-132100776 CCTAACCTGATACTGCAGCACGG + Intronic
1198040212 X:132843543-132843565 CCAAACCTCCAAACGCAGCTTGG + Intronic
1199472930 X:148214795-148214817 CAAAATCTACAAATGCAGCAGGG + Intergenic