ID: 1067083167

View in Genome Browser
Species Human (GRCh38)
Location 10:43223275-43223297
Sequence GTCCCCAAATAGAAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067083162_1067083167 18 Left 1067083162 10:43223234-43223256 CCACATGGTCGTATGTTATACCA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG No data
1067083164_1067083167 -5 Left 1067083164 10:43223257-43223279 CCAATGAAACCCAGTAAAGTCCC 0: 1
1: 0
2: 2
3: 6
4: 127
Right 1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG No data
1067083163_1067083167 -2 Left 1067083163 10:43223254-43223276 CCACCAATGAAACCCAGTAAAGT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG No data
1067083161_1067083167 30 Left 1067083161 10:43223222-43223244 CCAGAGTCTCTGCCACATGGTCG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067083167 Original CRISPR GTCCCCAAATAGAAGTGTGC AGG Intronic
No off target data available for this crispr