ID: 1067085520

View in Genome Browser
Species Human (GRCh38)
Location 10:43236009-43236031
Sequence CTCTTTCTCATTGGGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067085520_1067085526 -3 Left 1067085520 10:43236009-43236031 CCTGACACCCCAATGAGAAAGAG 0: 1
1: 0
2: 0
3: 8
4: 182
Right 1067085526 10:43236029-43236051 GAGAGAAGAGGGACAGCACATGG No data
1067085520_1067085528 5 Left 1067085520 10:43236009-43236031 CCTGACACCCCAATGAGAAAGAG 0: 1
1: 0
2: 0
3: 8
4: 182
Right 1067085528 10:43236037-43236059 AGGGACAGCACATGGAAATAGGG No data
1067085520_1067085527 4 Left 1067085520 10:43236009-43236031 CCTGACACCCCAATGAGAAAGAG 0: 1
1: 0
2: 0
3: 8
4: 182
Right 1067085527 10:43236036-43236058 GAGGGACAGCACATGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067085520 Original CRISPR CTCTTTCTCATTGGGGTGTC AGG (reversed) Intronic
900615456 1:3563682-3563704 CTCTCTTTCTTAGGGGTGTCAGG - Intronic
904046786 1:27613962-27613984 CTCTATCTCATGGGGGTTTTGGG - Intronic
904615144 1:31745565-31745587 CTCTCCCACAATGGGGTGTCAGG + Intronic
905384714 1:37594439-37594461 CTCTTTCTCTTTGAGATGTAAGG - Intronic
905616708 1:39406206-39406228 CTCTCTCTAATTAGGGTGTTAGG - Intronic
905980415 1:42220695-42220717 CTCGATCTCATTGGGGACTCCGG - Intronic
906604137 1:47153464-47153486 TTCTGTCTCATTGGGGTTCCAGG - Intergenic
908456973 1:64313495-64313517 CTCTATCTCATGGGGTTGTGAGG + Intergenic
909505132 1:76379627-76379649 CTCTTTCTCTTTGTGGTGTGTGG + Intronic
909674384 1:78223091-78223113 CTCTTTCTCCTAGGGTTGGCAGG + Intergenic
909827587 1:80144952-80144974 ATCTTTCTCATTTGTGTGTTTGG - Intergenic
912516535 1:110219936-110219958 CTCTGTCTCCTTGGGGAGTGAGG + Intronic
913517448 1:119616560-119616582 CCCTTTCCCATTGAGGTGCCAGG - Intergenic
913548887 1:119897042-119897064 CTGTTTGTCTTTGGGGTGCCAGG + Intergenic
914396363 1:147272881-147272903 CTCTAAGTCATTGTGGTGTCTGG + Intronic
915862933 1:159466196-159466218 CTGTTTCCCATTGTGATGTCTGG - Intergenic
916612827 1:166409913-166409935 TTCTGTCTCATTGGGGTTCCAGG + Intergenic
916938516 1:169656393-169656415 CTCTGTCTCACTGGTGTTTCAGG - Intergenic
921149202 1:212386360-212386382 ACCTGTCTCACTGGGGTGTCTGG - Intronic
924363875 1:243269024-243269046 CTCTTTCTTCATGGGGTCTCAGG + Intronic
924829039 1:247573182-247573204 TTCTTTCTCATTGGTGTTCCAGG + Intronic
1063317638 10:5021766-5021788 CACTTTCTCCTTGGGGTTACAGG + Intronic
1064465801 10:15580445-15580467 CTTTTTCTGATTTGGGTATCAGG - Intronic
1067085520 10:43236009-43236031 CTCTTTCTCATTGGGGTGTCAGG - Intronic
1068941418 10:62684699-62684721 CTCTATCTCATTGGGCTGAGTGG - Intergenic
1070356924 10:75648822-75648844 CTCTGTCTCATTTGGGTGGTGGG + Intronic
1071834644 10:89407426-89407448 GTCTTTCTCATTGGTGAGCCTGG - Intronic
1071910287 10:90224083-90224105 CTCTTCTTCTTTGGGGTGGCTGG + Intergenic
1073037118 10:100571856-100571878 CTCTTTCCCTTTGGAGTATCTGG - Intergenic
1075152877 10:119950566-119950588 CTCTCTCTCATTGGGTTCTTTGG - Intergenic
1075912469 10:126136697-126136719 CCCTTTCCCATGGTGGTGTCTGG - Intronic
1076149762 10:128152613-128152635 TTCTTTTTCTTTTGGGTGTCTGG + Intergenic
1076813939 10:132905209-132905231 ATGTTTCTCATTGGAGAGTCCGG + Intronic
1077990908 11:7411302-7411324 CTCTTCCTCATTTGTGTGTTTGG + Intronic
1078125218 11:8555019-8555041 CTCTCTCTCATAGGGCTGTAGGG + Intronic
1078474207 11:11617395-11617417 CACTTTCTCAGTGCAGTGTCTGG + Intronic
1079533915 11:21487527-21487549 CTCTTTCTCATTTGTGTGTATGG - Intronic
1079652711 11:22950312-22950334 CACTTTCTCTTTGCTGTGTCTGG - Intergenic
1085036909 11:73306414-73306436 CTCTCTCTCATTCGGTAGTCAGG + Intergenic
1090068188 11:123521386-123521408 CTTTTTCTCATTGGTTTGTAGGG + Intergenic
1092458094 12:8662588-8662610 CTCTGTCTCTTTAGGGTTTCAGG + Intronic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1094358521 12:29604633-29604655 CTCTTTGAGAATGGGGTGTCTGG - Intronic
1096877323 12:54640124-54640146 CTTTATCTCATTGGGTTGTTAGG - Intergenic
1098315223 12:69185560-69185582 CTGTATCTCACTGGAGTGTCGGG - Intergenic
1100209587 12:92387736-92387758 CTCTTTCTGATTGGTGAGCCTGG - Intergenic
1101779461 12:107822773-107822795 GTCTTTCTGATTGGTGAGTCTGG - Intergenic
1102535405 12:113577044-113577066 CTCTTTCTCTTTGAAGTGCCAGG + Intergenic
1103019518 12:117522719-117522741 CTCATTCTCATGGCGGTCTCAGG - Intronic
1103094335 12:118120808-118120830 TTGTTTCTAATTGGGGGGTCTGG + Intronic
1103339459 12:120213762-120213784 GTCTTCCTCATTGTGCTGTCTGG - Intronic
1107048832 13:36025348-36025370 TTCTTTCACATGTGGGTGTCTGG - Intronic
1107964468 13:45586838-45586860 CTCTTTCTCTGAGGGGGGTCTGG + Intronic
1109179982 13:59202119-59202141 CTTGTTCTCATGGGGGTGGCTGG + Intergenic
1109405065 13:61887025-61887047 TTCCTTCTCAGTGGGGTGACAGG - Intergenic
1109425517 13:62161840-62161862 ACCTTTCCCATTGGGGAGTCTGG - Intergenic
1109847344 13:68012722-68012744 CTCTTTCTGATTTGGGTGGGAGG - Intergenic
1110024362 13:70515557-70515579 CTGTTTCTCATCAGGGTTTCAGG - Intergenic
1110966348 13:81702768-81702790 CTTTTTCTCATTAGGGTGGGAGG + Intergenic
1110966601 13:81707516-81707538 CTTTTTCTCATTAGGGTGGGAGG - Intergenic
1117461664 14:55951550-55951572 CTCTCTCTCCATGGGGTCTCAGG - Intergenic
1118783973 14:69030157-69030179 CTTTTTCTGATTTGGGTGTCAGG - Intergenic
1122713312 14:103676949-103676971 CTCCTTATCAGTGGGGTGTGAGG - Intronic
1127703411 15:61524335-61524357 CTCTTTCTCAGTGATGTGTTAGG - Intergenic
1128453473 15:67820521-67820543 CTCTTCCTCAGTGGGGGCTCTGG - Intronic
1129997338 15:80017824-80017846 CTCTTTTTCAGTGTTGTGTCCGG - Intergenic
1130209313 15:81908802-81908824 CTCTCTCTTCTTGGGGTCTCTGG + Intergenic
1131410982 15:92208256-92208278 GTCTTTCTGATTGGTGAGTCTGG - Intergenic
1133428411 16:5713688-5713710 CTCTATGTCATTGTGGTGTCTGG + Intergenic
1133647866 16:7781227-7781249 ATCTTTCTCATTGGGATGGTAGG + Intergenic
1133898001 16:9947718-9947740 CTCTTTCTCTTACTGGTGTCTGG + Intronic
1135882313 16:26269916-26269938 CTCTTCCTGATTGTGGTGTGTGG - Intergenic
1137771607 16:51020163-51020185 CTCTTTCTCATGGGTTTGTGGGG - Intergenic
1138080930 16:54090883-54090905 CTCTTTCTCCTTGTAGTCTCAGG + Intronic
1138283935 16:55793773-55793795 CCCTTCCCCATTGGGGTTTCTGG - Intergenic
1138285067 16:55803214-55803236 CCCTTCCCCATTGGGGTTTCTGG + Exonic
1140766043 16:78158201-78158223 CTCTTTCACATGGTGATGTCAGG + Intronic
1141557127 16:84843593-84843615 CCCTTTCTCATAGGGTTGTTTGG + Intronic
1142559127 17:799626-799648 CTGTTTCTCTTTCGGGGGTCAGG + Exonic
1143908627 17:10229325-10229347 CTCTTTCTCATGGGGGACTGGGG - Intergenic
1148792380 17:50180668-50180690 CTCTGTCTCCTGGGGGTGCCTGG - Intergenic
1148913425 17:50955380-50955402 CTCTGGCTCATGTGGGTGTCCGG + Intergenic
1150249340 17:63697653-63697675 CCATTTCTCAATGGTGTGTCAGG + Exonic
1153418001 18:4871096-4871118 CTTTGTCTCATTTTGGTGTCAGG - Intergenic
1157348395 18:46861676-46861698 CTCTTTCTGATTTGGGGGTACGG - Intronic
1158122189 18:54060720-54060742 CACTTTATCATTGGGGAGTGTGG - Intergenic
1164382046 19:27743863-27743885 GTCTTTCTCATTTGAGTGCCTGG + Intergenic
1165890937 19:39111880-39111902 CTCTTTCTCACTGCGGGGCCTGG + Intergenic
1167525354 19:49980220-49980242 CACTGTCTTGTTGGGGTGTCGGG - Intronic
1167593004 19:50414588-50414610 CTGTTTCAGATTGGGGTCTCTGG + Intronic
1168530891 19:57127789-57127811 TTCTGTCTCACTGGGGTTTCAGG + Intronic
926719349 2:15947861-15947883 CTATTTCTCTTTTGAGTGTCAGG + Intergenic
928838204 2:35573648-35573670 CTCTTTCTCTTTTGTGTATCTGG + Intergenic
933102163 2:78274338-78274360 CTCTTTCTCTTTGGGCTCTTTGG - Intergenic
933267404 2:80196774-80196796 ATCTTTCGTATTGGGGTGGCTGG - Intronic
934231308 2:90184411-90184433 GGCTTTCTAATGGGGGTGTCTGG + Intergenic
936923943 2:117717715-117717737 TTATTTCTCTTTGAGGTGTCCGG - Intergenic
938666117 2:133539287-133539309 CTAGTTCTAGTTGGGGTGTCTGG + Intronic
944208755 2:197184688-197184710 CTTTTTCCCTTTGGGGTGGCAGG + Intronic
948092244 2:235303952-235303974 CCCTTTTTCTTTTGGGTGTCTGG - Intergenic
1174719379 20:52795720-52795742 ATCTATCTCATGGGGTTGTCAGG - Intergenic
1174878881 20:54255394-54255416 CTGTTTTTCATTGGCATGTCTGG - Intergenic
1175650233 20:60715430-60715452 CTAGTGCTCTTTGGGGTGTCAGG + Intergenic
1178253763 21:31031527-31031549 CTGTTTCTCTTTGGGGAGCCAGG - Intergenic
1181797006 22:25318490-25318512 CCCTTTCTCCTTGGGGTCTGGGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
949150289 3:758554-758576 CTCATTCTCATTCTGGTTTCAGG - Intergenic
963246894 3:143072101-143072123 CGCTTTCTCATGGGGGCTTCAGG + Intergenic
963526442 3:146421020-146421042 CTGTTTCTCTTTGGGATATCTGG - Intronic
964696999 3:159520207-159520229 CTCTTTCTCCATGCAGTGTCAGG - Intronic
965648674 3:170910121-170910143 CTCTTTCTTTTTGGGGTGTTGGG - Intergenic
968067317 3:195765752-195765774 TTCTTTCCCATTGGGGCCTCTGG + Intronic
969234869 4:5858725-5858747 CTCTTTCTCATATGGGTGATGGG - Intronic
969462511 4:7336223-7336245 CTCTCCCTCACTGGGGTTTCAGG + Intronic
969887217 4:10225858-10225880 TTCTTTATCTTTGGGGAGTCTGG - Intergenic
970020701 4:11564821-11564843 TTCTTTCTTATTGGAGTGTAAGG + Intergenic
970412015 4:15817982-15818004 TTCTGTCTCACTGGGGTTTCAGG - Intronic
972130050 4:35821472-35821494 CTCTTACTCATGGGAGGGTCAGG - Intergenic
973781955 4:54296489-54296511 CTCTTTCTCTTTGGGGTAAGGGG - Exonic
973874096 4:55197790-55197812 CTTTTTCTCATTTTGATGTCAGG - Intergenic
973981948 4:56314807-56314829 CTCTTTGTCCTTCGGGTTTCAGG - Exonic
975638198 4:76471650-76471672 CACTTTCTGACTGGGATGTCAGG - Intronic
976310968 4:83613022-83613044 CTCTTTCTCCTTTGTATGTCTGG + Intergenic
978657182 4:111078219-111078241 CTCTTCCTGATTTGGGTATCAGG - Intergenic
979119787 4:116883366-116883388 TTCTGTCTCATTGGGGTTCCAGG + Intergenic
979282307 4:118881452-118881474 TTCTTTCACATTTGGGGGTCTGG - Intronic
979903949 4:126259941-126259963 CTGTTTCACAATAGGGTGTCTGG + Intergenic
980187512 4:129480660-129480682 CTATTTCTCATAGGTGTGCCCGG + Intergenic
980428348 4:132656912-132656934 CTCTTCCTCATTTGCGTGTTTGG + Intergenic
983047510 4:163004731-163004753 TTCTGTCTCACTGGGGTTTCAGG + Intergenic
984107641 4:175569608-175569630 CTCTTTCTCCTTGTCGTGTGAGG + Intergenic
985083970 4:186294105-186294127 CTCTTTTGCCTTGGGGTATCCGG + Intergenic
986180236 5:5386269-5386291 TTCGTTCTCATTGGGGCATCAGG - Intergenic
986360400 5:6972483-6972505 CTTTTTCTCATAGCGGTGTGTGG - Intergenic
991259765 5:64654015-64654037 CTCTTTCTCTATGTGGTTTCAGG - Intergenic
991471836 5:66977020-66977042 CTCTGTGGCATTGGGGTGTAGGG + Intronic
992993288 5:82307325-82307347 CTAGTTATCATTGGGATGTCAGG - Intronic
993465715 5:88243962-88243984 CACTTTTTGATTGGGTTGTCTGG + Intronic
994524591 5:100887935-100887957 CTCTTGCTGATTGGGGTTACAGG - Intronic
996542900 5:124648462-124648484 CTCTTTCCCTTTGGGGTCCCAGG + Exonic
1000945241 5:167414600-167414622 CTCTATCTGATTGTTGTGTCTGG + Intronic
1001694322 5:173658852-173658874 TTCTTTCTCACAGGGGTGTTAGG - Intergenic
1002087479 5:176785118-176785140 CACTTTCTCATAGGGGATTCAGG + Intergenic
1002666178 5:180827138-180827160 CTGTTTCTCTTTCGGGTGACAGG + Intergenic
1003476498 6:6488459-6488481 CTCTTTGTCATTGGGGCCTGGGG + Intergenic
1003868743 6:10385193-10385215 CTCCTTCTCCTTGGGCTTTCCGG - Intergenic
1006163873 6:32053387-32053409 ATCTCTGTCATTGGGGTGACAGG - Intronic
1006164500 6:32056585-32056607 ATCTCTGTCATTGGGGTGACGGG - Intronic
1009294387 6:61926817-61926839 CTCTTTCTCTTTGAAGTTTCTGG - Intronic
1009638221 6:66295121-66295143 CTCTTTCTCACTTGTGTCTCTGG + Intergenic
1011276011 6:85632252-85632274 CTGTTTCTCTTTTGAGTGTCTGG - Intronic
1012370514 6:98500272-98500294 CTCTTTCGCATTGAGGGGTGAGG - Intergenic
1017172418 6:151470477-151470499 CTCTTTTTCATGGGGGAGTGGGG - Intergenic
1017622136 6:156309966-156309988 CTCTTTTAGATTGGGGGGTCAGG - Intergenic
1019194252 6:170272042-170272064 TACTTTCTCATTTGGGTCTCCGG - Intergenic
1019703000 7:2483235-2483257 CCCTTTCTGATTGGTCTGTCTGG - Intergenic
1021859232 7:24889801-24889823 CTCTCTTTCATTGTGGTGTGGGG - Intronic
1023008543 7:35902988-35903010 CTCCTTATCATTAGGGTGTCTGG + Intronic
1023016469 7:35972359-35972381 CTCCTTATCATTAGGGTGTCTGG + Intergenic
1023078182 7:36503616-36503638 ATCTTTCTGATTGGTGAGTCTGG + Intergenic
1023270618 7:38458029-38458051 CTCTTCCTCATTTGTGTGTTTGG + Intronic
1030021844 7:105282953-105282975 CACTTTATCATTGGGTTGTTGGG - Intronic
1033364105 7:140658373-140658395 CTCCTTCTCATTGGGCCTTCAGG + Intronic
1037137837 8:15484556-15484578 CTCTTTCTCATTCCGGTGTAGGG + Intronic
1037690581 8:21178155-21178177 CTCTTTCTCAACTGGTTGTCTGG + Intergenic
1038242149 8:25819781-25819803 CTCCTTCTCATGGGGATGTGAGG - Intergenic
1041287270 8:56273648-56273670 CTCTGTCTCACTGGGGTTCCAGG - Intergenic
1042190450 8:66180485-66180507 CTCTCTCCCATTGGGCTATCTGG + Intergenic
1043715505 8:83480276-83480298 CTGTTTCTGTGTGGGGTGTCAGG + Intergenic
1045939331 8:107720112-107720134 CTTTTTCTCATTTTGGTATCAGG - Intergenic
1046526904 8:115392395-115392417 GTGTTTCTCTTTGGTGTGTCTGG + Intergenic
1046805866 8:118478354-118478376 CTCTTTGTCTTTGGGTGGTCAGG - Intronic
1046814070 8:118564905-118564927 CTTTTTCTCTTTGGGGAGTATGG - Intronic
1049985657 9:948410-948432 CTCTTTGACATCTGGGTGTCTGG + Intronic
1054815889 9:69475173-69475195 CTTTCTCCCATTGAGGTGTCTGG - Intronic
1055563053 9:77541090-77541112 CTCTTCCTCATTTGTGTGTTTGG + Intronic
1056963959 9:91150704-91150726 CTCTTTCTCCTTGTGGCCTCAGG - Intergenic
1057351156 9:94300003-94300025 CTCTTTCTTAATGAGCTGTCGGG - Exonic
1057990932 9:99768790-99768812 CTCTTTCTCTGTGAGGTGTTTGG + Intergenic
1058259786 9:102814493-102814515 TTCTGTCTCATTGGGGTTCCAGG - Intergenic
1058830190 9:108809427-108809449 ACCTTTCTCACAGGGGTGTCAGG + Intergenic
1059439400 9:114297343-114297365 CTTTTTCTGGTTGGGGTATCAGG - Intronic
1191246631 X:58233320-58233342 ATCTTTCTCATTAGAATGTCTGG - Intergenic
1195941636 X:110172453-110172475 CTCTTCCTCATTCTGGTGTATGG + Intronic
1196529852 X:116773092-116773114 CTTTTTCTGATTTGGGTGTTAGG - Intergenic
1198074165 X:133179053-133179075 TTCTTTCTCAGTGGGGAGTGAGG - Intergenic
1199415977 X:147583727-147583749 CTCTTTTACGTTGGGGTTTCTGG - Intergenic
1200359229 X:155584959-155584981 CTCTTCCTCATTTGTGTGTAGGG - Intronic
1201407723 Y:13665220-13665242 ATCTTTCTGATTGGTGAGTCTGG + Intergenic
1201409132 Y:13680944-13680966 TTCTGTCTCACTGGGGTTTCAGG - Intergenic
1201462244 Y:14239426-14239448 TTCTTTCTCACTGGGGTTCCAGG - Intergenic