ID: 1067087408

View in Genome Browser
Species Human (GRCh38)
Location 10:43250236-43250258
Sequence GACACTGGTTTCACTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067087403_1067087408 -4 Left 1067087403 10:43250217-43250239 CCTGGGAGCCAGCTGCCCGGACA 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1067087408 10:43250236-43250258 GACACTGGTTTCACTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067087408 Original CRISPR GACACTGGTTTCACTACAGC TGG Intronic
No off target data available for this crispr