ID: 1067090632

View in Genome Browser
Species Human (GRCh38)
Location 10:43264407-43264429
Sequence GTATCAGAGGCCCTCCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067090628_1067090632 -5 Left 1067090628 10:43264389-43264411 CCAGCAATCCACCAGTGGGTATC 0: 1
1: 0
2: 8
3: 28
4: 154
Right 1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG No data
1067090626_1067090632 -3 Left 1067090626 10:43264387-43264409 CCCCAGCAATCCACCAGTGGGTA No data
Right 1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG No data
1067090627_1067090632 -4 Left 1067090627 10:43264388-43264410 CCCAGCAATCCACCAGTGGGTAT 0: 1
1: 0
2: 8
3: 55
4: 255
Right 1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG No data
1067090625_1067090632 -2 Left 1067090625 10:43264386-43264408 CCCCCAGCAATCCACCAGTGGGT 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG No data
1067090622_1067090632 7 Left 1067090622 10:43264377-43264399 CCTCTGACACCCCCAGCAATCCA 0: 1
1: 0
2: 3
3: 15
4: 270
Right 1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG No data
1067090621_1067090632 20 Left 1067090621 10:43264364-43264386 CCATAGGGGAGGGCCTCTGACAC 0: 1
1: 0
2: 2
3: 5
4: 117
Right 1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067090632 Original CRISPR GTATCAGAGGCCCTCCTCTA TGG Intronic
No off target data available for this crispr