ID: 1067091156

View in Genome Browser
Species Human (GRCh38)
Location 10:43266510-43266532
Sequence CGCACGCGGCGGGCGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091156_1067091179 29 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091156_1067091178 28 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091156_1067091173 17 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091173 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
1067091156_1067091164 -2 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091156_1067091180 30 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091156_1067091168 8 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091156_1067091166 3 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091166 10:43266536-43266558 CTGCCACGCCCGGCCCGGCCCGG No data
1067091156_1067091163 -7 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1067091163 10:43266526-43266548 GCGTGCGCTCCTGCCACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091156 Original CRISPR CGCACGCGGCGGGCGGGCGT GGG (reversed) Intronic
900237477 1:1599705-1599727 CGCACGCGGCGCGCGGCGGCCGG + Exonic
903652411 1:24930064-24930086 GGCAGGCTGCGGGCGGCCGTCGG - Intronic
903831375 1:26177358-26177380 GGCAGGAGGCGGACGGGCGTGGG + Intergenic
904672984 1:32179949-32179971 CGCGCGCGGGGGGCGCACGTGGG + Intronic
904837736 1:33349853-33349875 CGCGCGCGGCGGGCGCTCGAGGG + Intronic
913323523 1:117606633-117606655 CACACTCGGCGGGCCGGCGAAGG - Intronic
920922634 1:210311128-210311150 CGCACGTGGCGGGGGGGGGGGGG - Intergenic
923748330 1:236724175-236724197 CGCACGTGGTGGGTGGGGGTGGG + Intronic
924524739 1:244835778-244835800 CGCGCGCCGCGGGTGGGCGGTGG + Intronic
1064086340 10:12349171-12349193 CGGAAGCGCCGGGCGGGCGGGGG - Intergenic
1067091156 10:43266510-43266532 CGCACGCGGCGGGCGGGCGTGGG - Intronic
1076792846 10:132786026-132786048 CGCGCGGCCCGGGCGGGCGTCGG + Exonic
1076864525 10:133160342-133160364 CGGCAGCGGCGGGCGGGCGGGGG + Intergenic
1077253698 11:1571653-1571675 GCAACGCGGCGGGCGGGCGTGGG + Intronic
1080887057 11:36376896-36376918 CGGACGCTGCAGGCAGGCGTAGG + Intronic
1081672712 11:44950610-44950632 CGCAGGCGGCGGGCGGCGGGAGG + Intronic
1083579087 11:63813535-63813557 GGCGAGCGGCGGGCGGGCGGCGG + Exonic
1083648460 11:64186419-64186441 CGCGGGCGGCGGGCGGGAGCGGG + Intronic
1083657040 11:64234718-64234740 CGGGCGCGGCGGGCGGGGGCCGG - Exonic
1084606421 11:70175005-70175027 GGCAGGTGGCGGGCGGGGGTGGG - Intronic
1085396887 11:76210852-76210874 CGCGCGCGGGGGGCGGGGGCGGG + Intergenic
1085524733 11:77157591-77157613 CGCACACGGCAGGCTGGCTTGGG + Intronic
1088869008 11:113875603-113875625 CGCGCGCTGCGGGCGGGGGCGGG - Intergenic
1090699323 11:129279662-129279684 CGCGCGAGGAGGGCGGGCGGCGG + Intergenic
1097127794 12:56789058-56789080 CGGACGGGGCGGCCGGGCGGGGG + Intergenic
1104030861 12:125065254-125065276 CGCCCGCGGCCGGGGGGCGTGGG - Intergenic
1104650367 12:130527037-130527059 CTCAAGGGGCGGGCGGGAGTAGG - Intronic
1105768070 13:23579890-23579912 CGCAGGACGCGGGCGGGCGCCGG - Intronic
1113561456 13:111284873-111284895 AGCACGTGAGGGGCGGGCGTTGG + Intronic
1116820365 14:49621188-49621210 CGGAAGGGGCGGGCGGGCGGCGG - Exonic
1118809130 14:69260829-69260851 AGCGCGCGGCGAGCGGGCGGTGG + Intronic
1122162386 14:99793629-99793651 CGCCCGCGGCCGCCGGGCCTCGG - Intronic
1122629810 14:103102489-103102511 CGCGTGCGGCGGCCGGGCGCGGG + Exonic
1123630597 15:22257756-22257778 CCCGCGCGGCGGACGGGCGGCGG - Intergenic
1123684397 15:22786853-22786875 GGCAGGCGGCGGGCGGGTGGGGG + Intronic
1124427054 15:29570976-29570998 CGCGCGGGGCGGGCGGGGGAGGG - Intergenic
1127916424 15:63459134-63459156 TGGGCTCGGCGGGCGGGCGTGGG + Intergenic
1129382857 15:75178718-75178740 CACAGGCGGCGGGCGGGCGCGGG - Intergenic
1129862401 15:78872815-78872837 CGTGCGCGGCGGGCTGTCGTTGG + Exonic
1131493436 15:92882605-92882627 TGGCCGCGGCGGGCGGGCGGCGG + Intergenic
1132499819 16:280365-280387 GGCACGGGCCGGGCGGGCGGCGG + Intronic
1133271904 16:4614488-4614510 GGCTCGCGGCGGGCGGAGGTGGG - Intronic
1133784341 16:8963331-8963353 CGAGCCCGGCGGGCGGGCGGCGG + Exonic
1136365008 16:29805978-29806000 CGCGCGGGGAGGGCGGGCGGGGG - Intergenic
1140442638 16:74999303-74999325 GGCGAGCGGCGGGCGGGCGCGGG - Exonic
1141430492 16:83968423-83968445 CGCGCCCGGCCGGCGGGGGTGGG + Intergenic
1142671941 17:1491552-1491574 CGGCCGCGGGGGGCGGGTGTGGG - Intronic
1142811791 17:2399012-2399034 CCGCCGCGGCGGGCGGGGGTGGG - Intronic
1144656889 17:17042604-17042626 GGCCCGCGGCGGCCGGGCGGCGG + Intronic
1148035556 17:44656808-44656830 CGAACGGGGCGGGCGGGCGGGGG + Intronic
1148156585 17:45428193-45428215 GGCACCCGGCGGGCGGGGCTGGG - Intronic
1149626358 17:58083355-58083377 CGCGCGCGGCGGGGGGGCGGGGG + Intergenic
1151491035 17:74432448-74432470 CCCAGGCGGGGGGCGGGCGGGGG - Intronic
1151708396 17:75784995-75785017 CGCGCGCGGCGGGGGGGGGGGGG - Intronic
1151828719 17:76537636-76537658 CGTGCGCGGCGGGCGGGCGAGGG + Exonic
1152910528 17:83002874-83002896 CACACGCGGAGGGCGGGCTCAGG - Intronic
1152910614 17:83003175-83003197 CACACGCGGAGGGCGGGCTCAGG - Intronic
1153051989 18:908420-908442 CGCGCGGGGCGGGCGGCGGTGGG + Intronic
1153382602 18:4455378-4455400 CGGAGCCGGCGGGCGGGCGGCGG + Intergenic
1153794469 18:8609671-8609693 CGCAGCCGGGGGGCGGGCGGCGG + Exonic
1155258083 18:24015262-24015284 CGCGCGGGGCGGGCGCGCGGCGG - Intronic
1156099631 18:33578373-33578395 GGCGCGCGGCGGGCGGGCCGGGG - Intergenic
1156245091 18:35290260-35290282 CGCAGGCGCAGGGCGGGGGTGGG - Intergenic
1161849742 19:6732159-6732181 CGCAGGCGGCGGGGGTGGGTGGG + Intronic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1163655535 19:18543208-18543230 CGCCCGAGGCGTGCGGGGGTCGG - Intronic
1165349607 19:35268822-35268844 CGGAGCCGGCGGGCGGGCGGAGG + Intergenic
1168246949 19:55117263-55117285 AGCACGGCGCGGGCGGGCGGCGG + Exonic
1168528428 19:57106647-57106669 CGCACAAGGCGGGCGGGCGGGGG - Intergenic
925860709 2:8172842-8172864 CGCACGGGGCGGGATGGCGGTGG - Intergenic
932780080 2:74554219-74554241 TGCAAGCGGCGGCCGGGCGGCGG + Exonic
944457552 2:199911269-199911291 CGCACGCTGCGCGCGGACGTCGG + Exonic
944811037 2:203328111-203328133 CTCCAGCGGCGGGCGGGCGGCGG + Intergenic
945189013 2:207166892-207166914 CGCAAGCGGGGGGCGGGCGCAGG - Intronic
946248353 2:218399585-218399607 CGCTCCCGGCGGGCGGGCCTTGG + Intronic
946921313 2:224584811-224584833 GCCCCGCGGCCGGCGGGCGTGGG + Intronic
947542888 2:230990875-230990897 CGAGCGCGGCGGGCGGACGTCGG - Intergenic
948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG + Intronic
948468567 2:238163678-238163700 CCCACGCGGCGGGCGGGTGAGGG + Intronic
1168795887 20:610053-610075 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1170629939 20:18057507-18057529 CGCGCGCGGGGGCCGGGCCTGGG - Intronic
1172101211 20:32484562-32484584 GGCACGCGGGCGGCGGGCGCTGG - Intronic
1173821158 20:46021646-46021668 CGCGGGGGGCGGGCGGGCGGAGG + Intergenic
1175784875 20:61706132-61706154 AGCAGGCGCCGGGCAGGCGTCGG - Intronic
1176234884 20:64049552-64049574 GGAGCGCGGCGGGCGGGCGGCGG + Exonic
1176952654 21:15064903-15064925 CGCGGGTGGCGGGCGGGCGTGGG + Exonic
1179375458 21:40846762-40846784 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1180014682 21:45074524-45074546 CGCGCCCGGCGGGCCGGCGGGGG + Intronic
1180559066 22:16601423-16601445 GGCGCGCGGGGGGCGGGCGAGGG + Intergenic
1180650353 22:17370759-17370781 CGCACTCGGCGGCCAGGCATCGG + Intronic
1180736818 22:18023750-18023772 CGCGCGCCGCGGGCGGGTGCAGG + Intronic
1180876894 22:19178829-19178851 CGCACGGGGCGGGCTGGGGGCGG - Exonic
1181631893 22:24155974-24155996 CGCTCGCGGCGGGCCGGGGCGGG - Intronic
1182278640 22:29205883-29205905 GGCAGGAGGCGGGCGGGCGGGGG - Exonic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1183368702 22:37420273-37420295 CGCACGGGGCGGGTGCGCGATGG - Intronic
1183548463 22:38467903-38467925 CGCACACGGCAGCCGGGCGCAGG + Intergenic
950404520 3:12796553-12796575 CGCGGGAGGCGGGCGGGCCTGGG - Intronic
950610669 3:14124799-14124821 GGCGCGCGGCGGGCAGGCCTGGG - Exonic
951217682 3:20040354-20040376 CGAAGGGGGCGGGAGGGCGTGGG + Exonic
954085538 3:48241260-48241282 CGCAGGCGCCGCGCAGGCGTCGG + Intronic
954575022 3:51671205-51671227 CGTGCGCGGCGGGCGCGCGCAGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954795899 3:53161273-53161295 TCCGCGCGGCGGGCGGGCGCCGG - Exonic
956604955 3:71064871-71064893 CGCCCGCGCGGGCCGGGCGTGGG + Intronic
961540870 3:127598484-127598506 GGCGCGTGGCGGGCGGGCGCCGG + Intronic
963530649 3:146469777-146469799 CGCACACGGCGTGGGGGGGTGGG - Intronic
964452569 3:156826217-156826239 CTCACGCGCCGGGCGGAAGTGGG - Intronic
966182159 3:177197372-177197394 CGCACGCGGCCGGCGGCGGGGGG + Intronic
968674996 4:1872115-1872137 CACTCGCGGCGCCCGGGCGTTGG + Intronic
969330762 4:6472420-6472442 AGCGCGCGGTGGGCGGGCGGCGG + Intronic
969344938 4:6564335-6564357 CGCACCCGGTGGGGGGGCGGGGG - Intergenic
969597797 4:8158771-8158793 CGGAGCCGGCGGGCGGGCGGAGG - Intronic
969912276 4:10457424-10457446 CGCACGCGCGGGGCTGGCGCGGG - Intergenic
980930262 4:139177359-139177381 CCCACGCGGCGGGGGGGCGGGGG + Intergenic
982134256 4:152258711-152258733 GGCAGGCGGGGGGCGGGCGGGGG - Intergenic
983656499 4:170090030-170090052 CGCGCGCCGCGGGCGGCCATAGG - Intronic
1001529971 5:172454639-172454661 CGCGCGCGGTGGGCGGGGGTCGG - Intergenic
1002469797 5:179428569-179428591 CTCATGCGGCAGGCGGGTGTGGG - Intergenic
1002771177 6:292116-292138 GGCTCGCGGCCGCCGGGCGTGGG - Intronic
1004497666 6:16180347-16180369 AGCAGGCTGCGGGCGGGGGTGGG - Intergenic
1006366906 6:33621361-33621383 CGGGCGGGGCGGGCGGGCGGCGG + Exonic
1007451307 6:41941765-41941787 CGCGGGCGGCGGGCGGGCTGGGG - Exonic
1010703316 6:79077801-79077823 CGCTCGCCGCTCGCGGGCGTGGG - Intronic
1015376135 6:132512803-132512825 TGCACCCGGCCGGGGGGCGTGGG + Intronic
1017842426 6:158232435-158232457 TGGGCGCGGCGGGCGGGGGTCGG + Intronic
1018046317 6:159969283-159969305 TGCGGGCGGCGGGCGGGCGCGGG - Exonic
1018400225 6:163414327-163414349 CGCCCGGGGCGGGTGGGTGTGGG - Intronic
1019200006 6:170306598-170306620 CGGACGCGGCGCGCAGGCGCCGG - Intronic
1019545154 7:1570554-1570576 CTCAGGCGGCGGGCGGGCTGGGG + Intronic
1020204675 7:6105265-6105287 CGGCCGCGGCGGGCGGGCACCGG + Intronic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1026822291 7:73557647-73557669 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1028988205 7:97024141-97024163 CGCACGCGGCAGAAGGGAGTAGG - Intronic
1029461078 7:100694147-100694169 GGCGCGCGGCGGGCGGGGGCCGG + Intergenic
1029536998 7:101162953-101162975 CGCGCGCGGCGGGGGCGCGCGGG + Exonic
1032074574 7:128830345-128830367 CGGGCGCGGCGGGGGGGCGGCGG + Intergenic
1032096751 7:128942106-128942128 CGCACGCGGCGGGGTGGGGTGGG - Exonic
1032344312 7:131105793-131105815 CGCCCGCGGAGGGCGCGCGAGGG - Intergenic
1032459864 7:132102577-132102599 CCCCCGCGGAGGGCGGGGGTAGG - Intergenic
1034223051 7:149460323-149460345 CGCGCGGGGCGAGCGGGCGCGGG + Intronic
1034469716 7:151248744-151248766 CGGCGGCGGCGGGCGGGCGGCGG - Exonic
1034618252 7:152436584-152436606 GGCGCGCGGGGGGCGGGCGAGGG - Intergenic
1035398242 7:158548975-158548997 CTCAAGCGGGGGCCGGGCGTTGG - Intronic
1035450484 7:158974158-158974180 GGAACGCGGAGGGCGGGCGCTGG - Intergenic
1039843253 8:41308517-41308539 ACCCAGCGGCGGGCGGGCGTAGG + Intronic
1039948945 8:42153037-42153059 CGCGCGCGGCGGGCGGGGCGGGG + Exonic
1045114970 8:98972522-98972544 GGCACGTGGCCGGCGGGCCTGGG + Intergenic
1045489097 8:102655758-102655780 CCCGCGCCGCGGGCGGGGGTGGG + Exonic
1049628169 8:143636025-143636047 CGGTCGCGGCGGGCTGGCGGCGG + Intronic
1049709349 8:144056647-144056669 CGCACGGGGCGAGCGGGCTGTGG + Exonic
1049762647 8:144338078-144338100 AGCGCGCGGCGGGCGGGCCCCGG + Intergenic
1049766944 8:144359303-144359325 AGCACCGGACGGGCGGGCGTGGG - Exonic
1049769858 8:144374718-144374740 CTGAGGCGGCGGGCGGGCGGGGG + Intronic
1053697109 9:40649702-40649724 GGCACGGGGCGGGGGGCCGTGGG + Intergenic
1054308361 9:63448936-63448958 GGCACGGGGCGGGGGGCCGTGGG + Intergenic
1054440713 9:65258369-65258391 GGCACGGGGCGGGGGGGCGTGGG + Intergenic
1054489688 9:65763540-65763562 GGCAGGGGGCGGGGGGGCGTGGG - Intergenic
1056643251 9:88388543-88388565 GGCCCGCGCAGGGCGGGCGTGGG + Intronic
1059102441 9:111483668-111483690 CGGCGGCGGCGGGCGGGCCTCGG - Intronic
1061261421 9:129482772-129482794 CGCCAGCGGCGGCCGGGCGGAGG + Intergenic
1061472121 9:130835199-130835221 CGCAGGCGGCGGCGGGGCGGGGG + Intronic
1062162474 9:135087840-135087862 CGGCGGCGGCGGGCGGGCGGCGG + Exonic
1062230735 9:135480121-135480143 AGGCCGCGGCGGGCGGGCGGCGG + Intronic
1062363655 9:136198954-136198976 CGCACGTGGCGCGCCGGCTTGGG + Exonic
1062498708 9:136843326-136843348 CCCACGCGGCAGGCTGGCCTGGG - Intronic
1062507667 9:136886455-136886477 CGCACGCGGCGGAGCGGCGGCGG + Intronic
1062574542 9:137200171-137200193 CGGGCGCGGCGGGCGGGCTGGGG + Exonic
1202779561 9_KI270717v1_random:23362-23384 GGCACGGGGCGGGGGGGCGTGGG + Intergenic
1186496449 X:10015540-10015562 CGCGCGGGGCGGCCGGGCGGCGG + Exonic
1187900683 X:24025106-24025128 CGCACGAGGCGGCGCGGCGTCGG + Intronic
1197774638 X:130111064-130111086 CGACCGCGGCGGGCGGGCCGGGG - Intergenic
1198005502 X:132489420-132489442 CCCTCGCGGAGGCCGGGCGTGGG + Intronic
1199699081 X:150363372-150363394 GGCCGGCGGCGGGCGGGCGCGGG + Intronic
1200227719 X:154428396-154428418 CGAACGCGTCGGGTGGGCGTAGG + Intergenic