ID: 1067091157

View in Genome Browser
Species Human (GRCh38)
Location 10:43266511-43266533
Sequence GCGCACGCGGCGGGCGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091157_1067091173 16 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091173 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
1067091157_1067091179 28 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091157_1067091164 -3 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091157_1067091178 27 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091157_1067091166 2 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091166 10:43266536-43266558 CTGCCACGCCCGGCCCGGCCCGG No data
1067091157_1067091180 29 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091157_1067091163 -8 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091163 10:43266526-43266548 GCGTGCGCTCCTGCCACGCCCGG No data
1067091157_1067091168 7 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091157 Original CRISPR GCGCACGCGGCGGGCGGGCG TGG (reversed) Intronic