ID: 1067091158

View in Genome Browser
Species Human (GRCh38)
Location 10:43266516-43266538
Sequence CAGGAGCGCACGCGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091158_1067091178 22 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091158_1067091164 -8 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091158_1067091173 11 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091173 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
1067091158_1067091179 23 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091158_1067091166 -3 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091166 10:43266536-43266558 CTGCCACGCCCGGCCCGGCCCGG No data
1067091158_1067091185 30 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091185 10:43266569-43266591 CAGGTGCCCTGAAGGGGCGGAGG No data
1067091158_1067091183 27 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091183 10:43266566-43266588 CGCCAGGTGCCCTGAAGGGGCGG No data
1067091158_1067091168 2 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091158_1067091180 24 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091158 Original CRISPR CAGGAGCGCACGCGGCGGGC GGG (reversed) Intronic