ID: 1067091162

View in Genome Browser
Species Human (GRCh38)
Location 10:43266524-43266546
Sequence GGGCGTGGCAGGAGCGCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091162_1067091189 29 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091189 10:43266576-43266598 CCTGAAGGGGCGGAGGGTGCAGG No data
1067091162_1067091180 16 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091162_1067091190 30 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG No data
1067091162_1067091186 23 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091186 10:43266570-43266592 AGGTGCCCTGAAGGGGCGGAGGG No data
1067091162_1067091179 15 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091162_1067091178 14 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091162_1067091183 19 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091183 10:43266566-43266588 CGCCAGGTGCCCTGAAGGGGCGG No data
1067091162_1067091173 3 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091173 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
1067091162_1067091168 -6 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091162_1067091185 22 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091185 10:43266569-43266591 CAGGTGCCCTGAAGGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091162 Original CRISPR GGGCGTGGCAGGAGCGCACG CGG (reversed) Intronic