ID: 1067091164

View in Genome Browser
Species Human (GRCh38)
Location 10:43266531-43266553
Sequence CGCTCCTGCCACGCCCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091151_1067091164 24 Left 1067091151 10:43266484-43266506 CCCGGGCAGCGAACCTGCCCGCA No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091150_1067091164 25 Left 1067091150 10:43266483-43266505 CCCCGGGCAGCGAACCTGCCCGC No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091159_1067091164 -9 Left 1067091159 10:43266517-43266539 CCGCCCGCCGCGTGCGCTCCTGC No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091149_1067091164 30 Left 1067091149 10:43266478-43266500 CCAGGCCCCGGGCAGCGAACCTG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091158_1067091164 -8 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091153_1067091164 11 Left 1067091153 10:43266497-43266519 CCTGCCCGCAGTGCCCACGCCCG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091154_1067091164 7 Left 1067091154 10:43266501-43266523 CCCGCAGTGCCCACGCCCGCCCG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091155_1067091164 6 Left 1067091155 10:43266502-43266524 CCGCAGTGCCCACGCCCGCCCGC No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091156_1067091164 -2 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091157_1067091164 -3 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data
1067091152_1067091164 23 Left 1067091152 10:43266485-43266507 CCGGGCAGCGAACCTGCCCGCAG No data
Right 1067091164 10:43266531-43266553 CGCTCCTGCCACGCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091164 Original CRISPR CGCTCCTGCCACGCCCGGCC CGG Intronic