ID: 1067091165

View in Genome Browser
Species Human (GRCh38)
Location 10:43266535-43266557
Sequence CGGGCCGGGCCGGGCGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091165_1067091183 8 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091183 10:43266566-43266588 CGCCAGGTGCCCTGAAGGGGCGG No data
1067091165_1067091191 20 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091191 10:43266578-43266600 TGAAGGGGCGGAGGGTGCAGGGG No data
1067091165_1067091186 12 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091186 10:43266570-43266592 AGGTGCCCTGAAGGGGCGGAGGG No data
1067091165_1067091180 5 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091165_1067091192 21 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091192 10:43266579-43266601 GAAGGGGCGGAGGGTGCAGGGGG No data
1067091165_1067091190 19 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG No data
1067091165_1067091178 3 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091165_1067091173 -8 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091173 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
1067091165_1067091185 11 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091185 10:43266569-43266591 CAGGTGCCCTGAAGGGGCGGAGG No data
1067091165_1067091189 18 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091189 10:43266576-43266598 CCTGAAGGGGCGGAGGGTGCAGG No data
1067091165_1067091179 4 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091165_1067091193 27 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091193 10:43266585-43266607 GCGGAGGGTGCAGGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091165 Original CRISPR CGGGCCGGGCCGGGCGTGGC AGG (reversed) Intronic