ID: 1067091167

View in Genome Browser
Species Human (GRCh38)
Location 10:43266539-43266561
Sequence GGGCCGGGCCGGGCCGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091167_1067091189 14 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091189 10:43266576-43266598 CCTGAAGGGGCGGAGGGTGCAGG No data
1067091167_1067091180 1 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091167_1067091179 0 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091167_1067091183 4 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091183 10:43266566-43266588 CGCCAGGTGCCCTGAAGGGGCGG No data
1067091167_1067091192 17 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091192 10:43266579-43266601 GAAGGGGCGGAGGGTGCAGGGGG No data
1067091167_1067091191 16 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091191 10:43266578-43266600 TGAAGGGGCGGAGGGTGCAGGGG No data
1067091167_1067091185 7 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091185 10:43266569-43266591 CAGGTGCCCTGAAGGGGCGGAGG No data
1067091167_1067091190 15 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG No data
1067091167_1067091186 8 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091186 10:43266570-43266592 AGGTGCCCTGAAGGGGCGGAGGG No data
1067091167_1067091193 23 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091193 10:43266585-43266607 GCGGAGGGTGCAGGGGGTCCTGG No data
1067091167_1067091178 -1 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091167 Original CRISPR GGGCCGGGCCGGGCCGGGCG TGG (reversed) Intronic