ID: 1067091168

View in Genome Browser
Species Human (GRCh38)
Location 10:43266541-43266563
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091161_1067091168 -3 Left 1067091161 10:43266521-43266543 CCGCCGCGTGCGCTCCTGCCACG No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091153_1067091168 21 Left 1067091153 10:43266497-43266519 CCTGCCCGCAGTGCCCACGCCCG No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091155_1067091168 16 Left 1067091155 10:43266502-43266524 CCGCAGTGCCCACGCCCGCCCGC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091162_1067091168 -6 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091157_1067091168 7 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091154_1067091168 17 Left 1067091154 10:43266501-43266523 CCCGCAGTGCCCACGCCCGCCCG No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091159_1067091168 1 Left 1067091159 10:43266517-43266539 CCGCCCGCCGCGTGCGCTCCTGC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091160_1067091168 -2 Left 1067091160 10:43266520-43266542 CCCGCCGCGTGCGCTCCTGCCAC No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091158_1067091168 2 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data
1067091156_1067091168 8 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG No data
Right 1067091168 10:43266541-43266563 ACGCCCGGCCCGGCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type