ID: 1067091169

View in Genome Browser
Species Human (GRCh38)
Location 10:43266544-43266566
Sequence GGGCCGGGCCGGGCCGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091169_1067091179 -5 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091169_1067091193 18 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091193 10:43266585-43266607 GCGGAGGGTGCAGGGGGTCCTGG No data
1067091169_1067091178 -6 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091169_1067091180 -4 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091169_1067091190 10 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG No data
1067091169_1067091192 12 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091192 10:43266579-43266601 GAAGGGGCGGAGGGTGCAGGGGG No data
1067091169_1067091185 2 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091185 10:43266569-43266591 CAGGTGCCCTGAAGGGGCGGAGG No data
1067091169_1067091183 -1 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091183 10:43266566-43266588 CGCCAGGTGCCCTGAAGGGGCGG No data
1067091169_1067091186 3 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091186 10:43266570-43266592 AGGTGCCCTGAAGGGGCGGAGGG No data
1067091169_1067091191 11 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091191 10:43266578-43266600 TGAAGGGGCGGAGGGTGCAGGGG No data
1067091169_1067091189 9 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091189 10:43266576-43266598 CCTGAAGGGGCGGAGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091169 Original CRISPR GGGCCGGGCCGGGCCGGGCC GGG (reversed) Intronic