ID: 1067091172

View in Genome Browser
Species Human (GRCh38)
Location 10:43266550-43266572
Sequence CCTGGCGGGCCGGGCCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091172_1067091185 -4 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091185 10:43266569-43266591 CAGGTGCCCTGAAGGGGCGGAGG No data
1067091172_1067091183 -7 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091183 10:43266566-43266588 CGCCAGGTGCCCTGAAGGGGCGG No data
1067091172_1067091180 -10 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091180 10:43266563-43266585 GCCCGCCAGGTGCCCTGAAGGGG No data
1067091172_1067091193 12 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091193 10:43266585-43266607 GCGGAGGGTGCAGGGGGTCCTGG No data
1067091172_1067091195 28 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091195 10:43266601-43266623 GTCCTGGCGCCGTCCAGCCCGGG No data
1067091172_1067091186 -3 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091186 10:43266570-43266592 AGGTGCCCTGAAGGGGCGGAGGG No data
1067091172_1067091189 3 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091189 10:43266576-43266598 CCTGAAGGGGCGGAGGGTGCAGG No data
1067091172_1067091196 29 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091196 10:43266602-43266624 TCCTGGCGCCGTCCAGCCCGGGG No data
1067091172_1067091190 4 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG No data
1067091172_1067091194 27 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091194 10:43266600-43266622 GGTCCTGGCGCCGTCCAGCCCGG No data
1067091172_1067091192 6 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091192 10:43266579-43266601 GAAGGGGCGGAGGGTGCAGGGGG No data
1067091172_1067091191 5 Left 1067091172 10:43266550-43266572 CCGGCCCGGCCCGGCCCGCCAGG No data
Right 1067091191 10:43266578-43266600 TGAAGGGGCGGAGGGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091172 Original CRISPR CCTGGCGGGCCGGGCCGGGC CGG (reversed) Intronic