ID: 1067091178

View in Genome Browser
Species Human (GRCh38)
Location 10:43266561-43266583
Sequence CGGCCCGCCAGGTGCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091156_1067091178 28 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091165_1067091178 3 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091160_1067091178 18 Left 1067091160 10:43266520-43266542 CCCGCCGCGTGCGCTCCTGCCAC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091162_1067091178 14 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091170_1067091178 -7 Left 1067091170 10:43266545-43266567 CCGGCCCGGCCCGGCCCGGCCCG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091169_1067091178 -6 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091158_1067091178 22 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091167_1067091178 -1 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091161_1067091178 17 Left 1067091161 10:43266521-43266543 CCGCCGCGTGCGCTCCTGCCACG No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091157_1067091178 27 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data
1067091159_1067091178 21 Left 1067091159 10:43266517-43266539 CCGCCCGCCGCGTGCGCTCCTGC No data
Right 1067091178 10:43266561-43266583 CGGCCCGCCAGGTGCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067091178 Original CRISPR CGGCCCGCCAGGTGCCCTGA AGG Intronic