ID: 1067091179

View in Genome Browser
Species Human (GRCh38)
Location 10:43266562-43266584
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067091165_1067091179 4 Left 1067091165 10:43266535-43266557 CCTGCCACGCCCGGCCCGGCCCG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091170_1067091179 -6 Left 1067091170 10:43266545-43266567 CCGGCCCGGCCCGGCCCGGCCCG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091167_1067091179 0 Left 1067091167 10:43266539-43266561 CCACGCCCGGCCCGGCCCGGCCC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091169_1067091179 -5 Left 1067091169 10:43266544-43266566 CCCGGCCCGGCCCGGCCCGGCCC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091159_1067091179 22 Left 1067091159 10:43266517-43266539 CCGCCCGCCGCGTGCGCTCCTGC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091156_1067091179 29 Left 1067091156 10:43266510-43266532 CCCACGCCCGCCCGCCGCGTGCG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091161_1067091179 18 Left 1067091161 10:43266521-43266543 CCGCCGCGTGCGCTCCTGCCACG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091171_1067091179 -10 Left 1067091171 10:43266549-43266571 CCCGGCCCGGCCCGGCCCGCCAG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091158_1067091179 23 Left 1067091158 10:43266516-43266538 CCCGCCCGCCGCGTGCGCTCCTG No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091157_1067091179 28 Left 1067091157 10:43266511-43266533 CCACGCCCGCCCGCCGCGTGCGC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091162_1067091179 15 Left 1067091162 10:43266524-43266546 CCGCGTGCGCTCCTGCCACGCCC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data
1067091160_1067091179 19 Left 1067091160 10:43266520-43266542 CCCGCCGCGTGCGCTCCTGCCAC No data
Right 1067091179 10:43266562-43266584 GGCCCGCCAGGTGCCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type