ID: 1067092224

View in Genome Browser
Species Human (GRCh38)
Location 10:43273669-43273691
Sequence CTGTGCAAGGGGGCGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067092215_1067092224 -6 Left 1067092215 10:43273652-43273674 CCAGCAGAGGGAGGGGCCTGTGC No data
Right 1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG No data
1067092210_1067092224 6 Left 1067092210 10:43273640-43273662 CCAGTGATAGCTCCAGCAGAGGG No data
Right 1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067092224 Original CRISPR CTGTGCAAGGGGGCGGTGGG TGG Intergenic
No off target data available for this crispr