ID: 1067093161

View in Genome Browser
Species Human (GRCh38)
Location 10:43281708-43281730
Sequence CACTGAGAAGGTGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067093161_1067093171 9 Left 1067093161 10:43281708-43281730 CCTTATGCCCCACCTTCTCAGTG No data
Right 1067093171 10:43281740-43281762 TCCAGTCCCTTCTCAGAGGGAGG No data
1067093161_1067093169 5 Left 1067093161 10:43281708-43281730 CCTTATGCCCCACCTTCTCAGTG No data
Right 1067093169 10:43281736-43281758 AGGCTCCAGTCCCTTCTCAGAGG No data
1067093161_1067093170 6 Left 1067093161 10:43281708-43281730 CCTTATGCCCCACCTTCTCAGTG No data
Right 1067093170 10:43281737-43281759 GGCTCCAGTCCCTTCTCAGAGGG No data
1067093161_1067093173 10 Left 1067093161 10:43281708-43281730 CCTTATGCCCCACCTTCTCAGTG No data
Right 1067093173 10:43281741-43281763 CCAGTCCCTTCTCAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067093161 Original CRISPR CACTGAGAAGGTGGGGCATA AGG (reversed) Intergenic
No off target data available for this crispr