ID: 1067094884

View in Genome Browser
Species Human (GRCh38)
Location 10:43293914-43293936
Sequence GCCCAGAGCAAGACCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067094884_1067094889 -9 Left 1067094884 10:43293914-43293936 CCCCCCAGGGTCTTGCTCTGGGC No data
Right 1067094889 10:43293928-43293950 GCTCTGGGCCTTCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067094884 Original CRISPR GCCCAGAGCAAGACCCTGGG GGG (reversed) Intergenic
No off target data available for this crispr