ID: 1067094889

View in Genome Browser
Species Human (GRCh38)
Location 10:43293928-43293950
Sequence GCTCTGGGCCTTCCCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067094885_1067094889 -10 Left 1067094885 10:43293915-43293937 CCCCCAGGGTCTTGCTCTGGGCC No data
Right 1067094889 10:43293928-43293950 GCTCTGGGCCTTCCCCTCCCTGG No data
1067094884_1067094889 -9 Left 1067094884 10:43293914-43293936 CCCCCCAGGGTCTTGCTCTGGGC No data
Right 1067094889 10:43293928-43293950 GCTCTGGGCCTTCCCCTCCCTGG No data
1067094881_1067094889 3 Left 1067094881 10:43293902-43293924 CCACAGCTGAGACCCCCCAGGGT No data
Right 1067094889 10:43293928-43293950 GCTCTGGGCCTTCCCCTCCCTGG No data
1067094878_1067094889 21 Left 1067094878 10:43293884-43293906 CCAGGAGCAAAAGGCTTGCCACA No data
Right 1067094889 10:43293928-43293950 GCTCTGGGCCTTCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067094889 Original CRISPR GCTCTGGGCCTTCCCCTCCC TGG Intergenic
No off target data available for this crispr